Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813634276:

Variant ID: vg0813634276 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13634276
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.23, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ACAACCCATATAGCATCTTTCCCTCGAGGAGAACGTGGTAACCCAATTACAAAGTCCATAGTGATATGCTCCCATTTCCACTCTGGGATCTCTAATGGCC[A/G,T]
TAATAAACCTGCAGGCCTCTTATGTTCAGCCTTAACTTGCTGGCAAACTCCACAAGCTGACACATACTTAGCAATGTCTACCTTCATCCTTTTCCACCAG

Reverse complement sequence

CTGGTGGAAAAGGATGAAGGTAGACATTGCTAAGTATGTGTCAGCTTGTGGAGTTTGCCAGCAAGTTAAGGCTGAACATAAGAGGCCTGCAGGTTTATTA[T/C,A]
GGCCATTAGAGATCCCAGAGTGGAAATGGGAGCATATCACTATGGACTTTGTAATTGGGTTACCACGTTCTCCTCGAGGGAAAGATGCTATATGGGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.90%	24.60%	0.72%	4.80%	NA
All Indica	2759	84.40%	6.70%	1.20%	7.76%	NA
All Japonica	1512	57.70%	41.50%	0.00%	0.79%	NA
Aus	269	16.70%	82.90%	0.00%	0.37%	NA
Indica I	595	97.50%	0.20%	0.34%	2.02%	NA
Indica II	465	88.80%	6.20%	0.65%	4.30%	NA
Indica III	913	77.90%	6.70%	1.97%	13.47%	NA
Indica Intermediate	786	79.40%	11.80%	1.27%	7.51%	NA
Temperate Japonica	767	86.40%	13.30%	0.00%	0.26%	NA
Tropical Japonica	504	25.80%	73.80%	0.00%	0.40%	NA
Japonica Intermediate	241	33.20%	63.50%	0.00%	3.32%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813634276	A -> G	LOC_Os08g22660.1	missense_variant ; p.Trp187Arg; MODERATE	nonsynonymous_codon ; W187R	Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698	probably damaging	-2.79	DELETERIOUS	0.01
vg0813634276	A -> T	LOC_Os08g22660.1	missense_variant ; p.Trp187Arg; MODERATE	N	Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0813634276	A -> T	LOC_Os08g22670.1	upstream_gene_variant ; 3653.0bp to feature; MODIFIER	N	Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0813634276	A -> T	LOC_Os08g22650.1	downstream_gene_variant ; 3676.0bp to feature; MODIFIER	N	Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0813634276	A -> DEL	LOC_Os08g22660.1	N	frameshift_variant	Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813634276	NA	7.27E-19	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813634276	NA	3.93E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813634276	NA	1.01E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.01E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	2.59E-10	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	8.32E-10	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.00E-10	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.93E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	5.34E-07	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.88E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	5.33E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	3.80E-06	3.80E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	6.51E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.21E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	8.47E-11	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	2.33E-10	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	5.25E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	4.35E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	8.32E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	3.44E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	4.84E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	3.37E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	2.27E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	1.22E-11	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	5.84E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	2.95E-14	mr1794_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	7.85E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276	NA	3.86E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251