\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813634276:

Variant ID: vg0813634276 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13634276
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.23, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ACAACCCATATAGCATCTTTCCCTCGAGGAGAACGTGGTAACCCAATTACAAAGTCCATAGTGATATGCTCCCATTTCCACTCTGGGATCTCTAATGGCC[A/G,T]
TAATAAACCTGCAGGCCTCTTATGTTCAGCCTTAACTTGCTGGCAAACTCCACAAGCTGACACATACTTAGCAATGTCTACCTTCATCCTTTTCCACCAG

Reverse complement sequence

CTGGTGGAAAAGGATGAAGGTAGACATTGCTAAGTATGTGTCAGCTTGTGGAGTTTGCCAGCAAGTTAAGGCTGAACATAAGAGGCCTGCAGGTTTATTA[T/C,A]
GGCCATTAGAGATCCCAGAGTGGAAATGGGAGCATATCACTATGGACTTTGTAATTGGGTTACCACGTTCTCCTCGAGGGAAAGATGCTATATGGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.90% 24.60% 0.72% 4.80% NA
All Indica  2759 84.40% 6.70% 1.20% 7.76% NA
All Japonica  1512 57.70% 41.50% 0.00% 0.79% NA
Aus  269 16.70% 82.90% 0.00% 0.37% NA
Indica I  595 97.50% 0.20% 0.34% 2.02% NA
Indica II  465 88.80% 6.20% 0.65% 4.30% NA
Indica III  913 77.90% 6.70% 1.97% 13.47% NA
Indica Intermediate  786 79.40% 11.80% 1.27% 7.51% NA
Temperate Japonica  767 86.40% 13.30% 0.00% 0.26% NA
Tropical Japonica  504 25.80% 73.80% 0.00% 0.40% NA
Japonica Intermediate  241 33.20% 63.50% 0.00% 3.32% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813634276 A -> G LOC_Os08g22660.1 missense_variant ; p.Trp187Arg; MODERATE nonsynonymous_codon ; W187R Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698 probably damaging -2.79 DELETERIOUS 0.01
vg0813634276 A -> T LOC_Os08g22660.1 missense_variant ; p.Trp187Arg; MODERATE N Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0813634276 A -> T LOC_Os08g22670.1 upstream_gene_variant ; 3653.0bp to feature; MODIFIER N Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0813634276 A -> T LOC_Os08g22650.1 downstream_gene_variant ; 3676.0bp to feature; MODIFIER N Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0813634276 A -> DEL LOC_Os08g22660.1 N frameshift_variant Average:63.795; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813634276 NA 7.27E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813634276 NA 3.93E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813634276 NA 1.01E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.01E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 2.59E-10 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 8.32E-10 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.00E-10 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.93E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 5.34E-07 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.88E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 5.33E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 3.80E-06 3.80E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 6.51E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.21E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 8.47E-11 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 2.33E-10 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 5.25E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 4.35E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 8.32E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 3.44E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 4.84E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 3.37E-17 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 2.27E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 1.22E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 5.84E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 2.95E-14 mr1794_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 7.85E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813634276 NA 3.86E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251