\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813628932:

Variant ID: vg0813628932 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13628932
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCAACACTCTGACTAATATGATCAAGTCCTTGGTTGATGTTACGATTGCTGAGCATCAAGCTAAAGGACCAACTTTTCTTCCTGATGGCGTATTTCTA[C/T]
AGTATAGGAATCTGGTGTCCAGCAAGCAACAACCTGTCTCTGGTATAAATCTAGAACAGCCGATGGCATCAACTTCAGCTTTTGGAAAATAGGGGCAGCA

Reverse complement sequence

TGCTGCCCCTATTTTCCAAAAGCTGAAGTTGATGCCATCGGCTGTTCTAGATTTATACCAGAGACAGGTTGTTGCTTGCTGGACACCAGATTCCTATACT[G/A]
TAGAAATACGCCATCAGGAAGAAAAGTTGGTCCTTTAGCTTGATGCTCAGCAATCGTAACATCAACCAAGGACTTGATCATATTAGTCAGAGTGTTGACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 46.30% 1.86% 3.22% NA
All Indica  2759 79.40% 12.40% 2.94% 5.33% NA
All Japonica  1512 1.90% 97.50% 0.46% 0.13% NA
Aus  269 16.00% 83.30% 0.00% 0.74% NA
Indica I  595 93.60% 1.20% 3.03% 2.18% NA
Indica II  465 83.00% 10.30% 1.29% 5.38% NA
Indica III  913 72.00% 17.10% 4.05% 6.90% NA
Indica Intermediate  786 75.10% 16.50% 2.54% 5.85% NA
Temperate Japonica  767 1.80% 97.90% 0.13% 0.13% NA
Tropical Japonica  504 1.40% 98.40% 0.00% 0.20% NA
Japonica Intermediate  241 3.30% 94.20% 2.49% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813628932 C -> T LOC_Os08g22650.1 stop_gained ; p.Gln363*; HIGH stop_gained Average:60.145; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0813628932 C -> DEL LOC_Os08g22650.1 N frameshift_variant Average:60.145; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813628932 NA 5.55E-07 mr1134 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 6.05E-06 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 5.13E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 2.53E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 8.50E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 4.91E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 3.32E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 8.07E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 4.75E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 7.24E-06 6.23E-10 mr1134_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 2.32E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 3.52E-06 mr1504_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 6.51E-07 6.51E-07 mr1670_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 4.27E-06 1.38E-08 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 7.91E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 2.54E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 3.23E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 2.07E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813628932 NA 1.41E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251