\
| Variant ID: vg0813557256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13557256 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 86. )
GTTCAATTTTCGTGTCCGATGGTTTGTTCAATTTGCCGAAAGTATGGGAATCAAACTGTTAAATTCTTCACCATATTATGCACAAGCTAATGGGCAAGCC[A/G]
AGGCATCTAACAAAAGCTTGATCAAGTTGATTAAGAGGAAGATTTCTGATTATCCTCGGCAATGGCATGCTCGGTTGCCCGAAGCATTGTGGTCTTATCG
CGATAAGACCACAATGCTTCGGGCAACCGAGCATGCCATTGCCGAGGATAATCAGAAATCTTCCTCTTAATCAACTTGATCAAGCTTTTGTTAGATGCCT[T/C]
GGCTTGCCCATTAGCTTGTGCATAATATGGTGAAGAATTTAACAGTTTGATTCCCATACTTTCGGCAAATTGAACAAACCATCGGACACGAAAATTGAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.30% | 21.10% | 2.88% | 49.72% | NA |
| All Indica | 2759 | 15.80% | 4.20% | 4.49% | 75.50% | NA |
| All Japonica | 1512 | 37.80% | 56.50% | 0.07% | 5.56% | NA |
| Aus | 269 | 39.00% | 1.90% | 2.97% | 56.13% | NA |
| Indica I | 595 | 2.50% | 2.70% | 4.03% | 90.76% | NA |
| Indica II | 465 | 12.30% | 7.30% | 4.95% | 75.48% | NA |
| Indica III | 913 | 23.10% | 2.10% | 4.49% | 70.32% | NA |
| Indica Intermediate | 786 | 19.50% | 6.00% | 4.58% | 69.97% | NA |
| Temperate Japonica | 767 | 6.10% | 85.40% | 0.13% | 8.34% | NA |
| Tropical Japonica | 504 | 74.20% | 24.40% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 62.70% | 32.00% | 0.00% | 5.39% | NA |
| VI/Aromatic | 96 | 92.70% | 2.10% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 43.30% | 23.30% | 2.22% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813557256 | A -> G | LOC_Os08g22500.1 | missense_variant ; p.Lys442Glu; MODERATE | nonsynonymous_codon ; K442E | Average:16.46; most accessible tissue: Callus, score: 56.714 | benign |
-0.281 |
TOLERATED | 1.00 |
| vg0813557256 | A -> DEL | LOC_Os08g22500.1 | N | frameshift_variant | Average:16.46; most accessible tissue: Callus, score: 56.714 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813557256 | NA | 2.30E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0813557256 | NA | 2.47E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 2.41E-08 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 2.08E-11 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 1.24E-06 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 4.03E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 3.88E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 8.50E-12 | mr1503 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 4.50E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 3.05E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 1.34E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | 6.64E-06 | 6.64E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 1.03E-10 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 1.06E-10 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 5.50E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 4.88E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813557256 | NA | 4.22E-13 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |