\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813554256:

Variant ID: vg0813554256 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13554256
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, A: 0.33, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGGAATATTCATGTCACCTGGACACTATGGAATGGTTGGATTATTGTGGAATTGGATTCACACCTCCCCCTCTATTCAAAATCCTCAAAAAGGTTTTA[A/G]
GCTGGGCTCGGGGTGCATGGTTTTGATAGTAGTACCTCGGCCATATAAGGACCGGTCTTCGGGCCTCTGCTGCAAAGCACTACCGTACTTCCACATGTCT

Reverse complement sequence

AGACATGTGGAAGTACGGTAGTGCTTTGCAGCAGAGGCCCGAAGACCGGTCCTTATATGGCCGAGGTACTACTATCAAAACCATGCACCCCGAGCCCAGC[T/C]
TAAAACCTTTTTGAGGATTTTGAATAGAGGGGGAGGTGTGAATCCAATTCCACAATAATCCAACCATTCCATAGTGTCCAGGTGACATGAATATTCCCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.40% 18.40% 25.41% 36.73% NA
All Indica  2759 1.40% 15.20% 27.40% 56.03% NA
All Japonica  1512 56.50% 13.20% 22.42% 7.87% NA
Aus  269 0.00% 84.00% 1.49% 14.50% NA
Indica I  595 1.30% 2.70% 31.09% 64.87% NA
Indica II  465 1.50% 9.20% 23.23% 66.02% NA
Indica III  913 0.80% 23.00% 30.89% 45.35% NA
Indica Intermediate  786 2.20% 19.00% 23.03% 55.85% NA
Temperate Japonica  767 85.40% 9.90% 2.22% 2.48% NA
Tropical Japonica  504 24.80% 18.10% 48.02% 9.13% NA
Japonica Intermediate  241 31.10% 13.30% 33.20% 22.41% NA
VI/Aromatic  96 3.10% 11.50% 77.08% 8.33% NA
Intermediate  90 23.30% 18.90% 31.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813554256 A -> G LOC_Os08g22500.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:12.031; most accessible tissue: Callus, score: 27.102 N N N N
vg0813554256 A -> G LOC_Os08g22480.1 downstream_gene_variant ; 1941.0bp to feature; MODIFIER silent_mutation Average:12.031; most accessible tissue: Callus, score: 27.102 N N N N
vg0813554256 A -> G LOC_Os08g22510.1 downstream_gene_variant ; 4417.0bp to feature; MODIFIER silent_mutation Average:12.031; most accessible tissue: Callus, score: 27.102 N N N N
vg0813554256 A -> G LOC_Os08g22480-LOC_Os08g22500 intergenic_region ; MODIFIER silent_mutation Average:12.031; most accessible tissue: Callus, score: 27.102 N N N N
vg0813554256 A -> DEL N N silent_mutation Average:12.031; most accessible tissue: Callus, score: 27.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813554256 NA 4.13E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813554256 NA 2.26E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813554256 NA 6.09E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 1.05E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 1.25E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 1.67E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 9.84E-11 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 1.88E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 5.47E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 4.70E-11 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 1.15E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 2.77E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 2.19E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 6.03E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 4.73E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 8.62E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 2.93E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 5.50E-11 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 2.08E-10 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 3.74E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 4.06E-09 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 4.28E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 5.66E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 3.06E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 3.86E-13 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813554256 NA 2.63E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251