\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813540176:

Variant ID: vg0813540176 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13540176
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAAATCAAGTGATTGGGATAGATCGGTCATCATGCCGAGACAATATAAATCACTTAGATCGAAATATATATCAATAACAAGACTATATATGTTTATAG[C/T]
GTAGCCGATCGGATAAATCTAGCATGTATCGGCTAATACTCCGATACTACTCTATATTAGGATATTAAAGCAAGAATAATATATCGAACAAGAGCCTACT

Reverse complement sequence

AGTAGGCTCTTGTTCGATATATTATTCTTGCTTTAATATCCTAATATAGAGTAGTATCGGAGTATTAGCCGATACATGCTAGATTTATCCGATCGGCTAC[G/A]
CTATAAACATATATAGTCTTGTTATTGATATATATTTCGATCTAAGTGATTTATATTGTCTCGGCATGATGACCGATCTATCCCAATCACTTGATTTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 0.40% 1.65% 51.06% NA
All Indica  2759 15.20% 0.80% 2.68% 81.37% NA
All Japonica  1512 93.50% 0.00% 0.07% 6.42% NA
Aus  269 84.40% 0.00% 0.74% 14.87% NA
Indica I  595 5.90% 0.50% 1.34% 92.27% NA
Indica II  465 11.80% 0.90% 3.87% 83.44% NA
Indica III  913 20.60% 1.10% 2.63% 75.68% NA
Indica Intermediate  786 17.90% 0.50% 3.05% 78.50% NA
Temperate Japonica  767 95.30% 0.00% 0.13% 4.56% NA
Tropical Japonica  504 94.40% 0.00% 0.00% 5.56% NA
Japonica Intermediate  241 85.90% 0.00% 0.00% 14.11% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 66.70% 0.00% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813540176 C -> T LOC_Os08g22440.1 upstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:8.958; most accessible tissue: Callus, score: 29.833 N N N N
vg0813540176 C -> T LOC_Os08g22430.1 downstream_gene_variant ; 2910.0bp to feature; MODIFIER silent_mutation Average:8.958; most accessible tissue: Callus, score: 29.833 N N N N
vg0813540176 C -> T LOC_Os08g22450.1 downstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:8.958; most accessible tissue: Callus, score: 29.833 N N N N
vg0813540176 C -> T LOC_Os08g22440-LOC_Os08g22450 intergenic_region ; MODIFIER silent_mutation Average:8.958; most accessible tissue: Callus, score: 29.833 N N N N
vg0813540176 C -> DEL N N silent_mutation Average:8.958; most accessible tissue: Callus, score: 29.833 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813540176 2.65E-06 NA mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813540176 9.45E-08 NA mr1754 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813540176 6.93E-06 NA mr1754 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251