Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813540176:

Variant ID: vg0813540176 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13540176
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAAATCAAGTGATTGGGATAGATCGGTCATCATGCCGAGACAATATAAATCACTTAGATCGAAATATATATCAATAACAAGACTATATATGTTTATAG[C/T]
GTAGCCGATCGGATAAATCTAGCATGTATCGGCTAATACTCCGATACTACTCTATATTAGGATATTAAAGCAAGAATAATATATCGAACAAGAGCCTACT

Reverse complement sequence

AGTAGGCTCTTGTTCGATATATTATTCTTGCTTTAATATCCTAATATAGAGTAGTATCGGAGTATTAGCCGATACATGCTAGATTTATCCGATCGGCTAC[G/A]
CTATAAACATATATAGTCTTGTTATTGATATATATTTCGATCTAAGTGATTTATATTGTCTCGGCATGATGACCGATCTATCCCAATCACTTGATTTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	0.40%	1.65%	51.06%	NA
All Indica	2759	15.20%	0.80%	2.68%	81.37%	NA
All Japonica	1512	93.50%	0.00%	0.07%	6.42%	NA
Aus	269	84.40%	0.00%	0.74%	14.87%	NA
Indica I	595	5.90%	0.50%	1.34%	92.27%	NA
Indica II	465	11.80%	0.90%	3.87%	83.44%	NA
Indica III	913	20.60%	1.10%	2.63%	75.68%	NA
Indica Intermediate	786	17.90%	0.50%	3.05%	78.50%	NA
Temperate Japonica	767	95.30%	0.00%	0.13%	4.56%	NA
Tropical Japonica	504	94.40%	0.00%	0.00%	5.56%	NA
Japonica Intermediate	241	85.90%	0.00%	0.00%	14.11%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	66.70%	0.00%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813540176	C -> T	LOC_Os08g22440.1	upstream_gene_variant ; 549.0bp to feature; MODIFIER	silent_mutation	Average:8.958; most accessible tissue: Callus, score: 29.833	N	N	N	N
vg0813540176	C -> T	LOC_Os08g22430.1	downstream_gene_variant ; 2910.0bp to feature; MODIFIER	silent_mutation	Average:8.958; most accessible tissue: Callus, score: 29.833	N	N	N	N
vg0813540176	C -> T	LOC_Os08g22450.1	downstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:8.958; most accessible tissue: Callus, score: 29.833	N	N	N	N
vg0813540176	C -> T	LOC_Os08g22440-LOC_Os08g22450	intergenic_region ; MODIFIER	silent_mutation	Average:8.958; most accessible tissue: Callus, score: 29.833	N	N	N	N
vg0813540176	C -> DEL	N	N	silent_mutation	Average:8.958; most accessible tissue: Callus, score: 29.833	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813540176	2.65E-06	NA	mr1645	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813540176	9.45E-08	NA	mr1754	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813540176	6.93E-06	NA	mr1754	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251