\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813447304:

Variant ID: vg0813447304 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13447304
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATACAAGTCAAGGTGCGCCTAATTGGTTGCCACCGATTCAGCCAGGCTCGGGACCTTCGCCATGGAGTCAAGGACAGCAGTTCGACTTCGGCAACACT[G/A]
CTCAGGTGCCAACCGTTCGGCAGCAAGTTCCAACCCCAGGCTTCGGAACAAACCAAGCACCAAACCAAGCTGCCATGATGTAGTCGCAGCCAATCTTTGA

Reverse complement sequence

TCAAAGATTGGCTGCGACTACATCATGGCAGCTTGGTTTGGTGCTTGGTTTGTTCCGAAGCCTGGGGTTGGAACTTGCTGCCGAACGGTTGGCACCTGAG[C/T]
AGTGTTGCCGAAGTCGAACTGCTGTCCTTGACTCCATGGCGAAGGTCCCGAGCCTGGCTGAATCGGTGGCAACCAATTAGGCGCACCTTGACTTGTATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 10.60% 0.55% 0.06% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 71.20% 27.40% 1.19% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 40.90% 55.60% 3.37% 0.20% NA
Japonica Intermediate  241 49.80% 49.00% 0.41% 0.83% NA
VI/Aromatic  96 21.90% 70.80% 7.29% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813447304 G -> A LOC_Os08g22310.1 missense_variant ; p.Ala259Thr; MODERATE nonsynonymous_codon ; A259T Average:69.806; most accessible tissue: Zhenshan97 flag leaf, score: 87.846 benign 0.344 TOLERATED 0.40
vg0813447304 G -> DEL LOC_Os08g22310.1 N frameshift_variant Average:69.806; most accessible tissue: Zhenshan97 flag leaf, score: 87.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0813447304 G A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813447304 NA 9.11E-12 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 8.17E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 2.81E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 1.06E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 3.61E-06 NA mr1235 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 2.72E-06 1.48E-11 mr1235 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 5.58E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 5.25E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 2.65E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 5.03E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 9.66E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 2.85E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 7.51E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813447304 NA 1.17E-07 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251