\
| Variant ID: vg0813435160 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13435160 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 120. )
TCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGGTGGCGAT[G/A]
CGCCGAGATTGTATTGAACGTGTGTATCCACTGATTACATGGGGTTCGGGGCCTATTTATACCCGAAAATTACAGACTATGTCCATCTCGGACACGACTC
GAGTCGTGTCCGAGATGGACATAGTCTGTAATTTTCGGGTATAAATAGGCCCCGAACCCCATGTAATCAGTGGATACACACGTTCAATACAATCTCGGCG[C/T]
ATCGCCACCCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 5.50% | 31.23% | 6.52% | NA |
| All Indica | 2759 | 35.00% | 9.30% | 45.52% | 10.18% | NA |
| All Japonica | 1512 | 95.40% | 0.10% | 3.17% | 1.32% | NA |
| Aus | 269 | 43.10% | 0.70% | 55.39% | 0.74% | NA |
| Indica I | 595 | 24.20% | 2.50% | 52.10% | 21.18% | NA |
| Indica II | 465 | 37.40% | 4.90% | 48.60% | 9.03% | NA |
| Indica III | 913 | 42.30% | 16.60% | 38.12% | 2.96% | NA |
| Indica Intermediate | 786 | 33.20% | 8.50% | 47.33% | 10.94% | NA |
| Temperate Japonica | 767 | 96.50% | 0.00% | 2.09% | 1.43% | NA |
| Tropical Japonica | 504 | 95.00% | 0.20% | 4.17% | 0.60% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.00% | 4.56% | 2.49% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 2.20% | 25.56% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813435160 | G -> A | LOC_Os08g22300.1 | downstream_gene_variant ; 3114.0bp to feature; MODIFIER | silent_mutation | Average:12.244; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0813435160 | G -> A | LOC_Os08g22284.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.244; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0813435160 | G -> DEL | N | N | silent_mutation | Average:12.244; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813435160 | 5.77E-07 | 2.58E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | 4.99E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | 1.75E-07 | 4.61E-09 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | 3.00E-07 | 2.16E-10 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | 9.74E-07 | NA | mr1900 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | 6.92E-10 | 6.92E-10 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | NA | 6.10E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | NA | 3.13E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | NA | 4.56E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813435160 | NA | 1.27E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |