Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813419843:

Variant ID: vg0813419843 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13419843
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGATCTCCCAAGATCCATTGAAGAACAGAAGGCAAGATTAAAATCGACTATCAAGAATGTTGCCGATCTCACCAAGTCTTTAAAAGTCATTCCTGGAAC[C/T]
GACACCCAAGATGCCCAAGCCATTGAAGAAGTGGAACAAATCAGGCAAAGGGCTATTTCGGCTATCCAGCAATACTTGTCTTGGTGACTTTCCGTGTAAT

Reverse complement sequence

ATTACACGGAAAGTCACCAAGACAAGTATTGCTGGATAGCCGAAATAGCCCTTTGCCTGATTTGTTCCACTTCTTCAATGGCTTGGGCATCTTGGGTGTC[G/A]
GTTCCAGGAATGACTTTTAAAGACTTGGTGAGATCGGCAACATTCTTGATAGTCGATTTTAATCTTGCCTTCTGTTCTTCAATGGATCTTGGGAGATCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	11.60%	8.68%	21.52%	NA
All Indica	2759	61.40%	0.30%	13.59%	24.72%	NA
All Japonica	1512	65.20%	28.60%	0.33%	5.89%	NA
Aus	269	6.70%	0.00%	8.55%	84.76%	NA
Indica I	595	67.60%	0.00%	6.55%	25.88%	NA
Indica II	465	51.40%	0.40%	19.35%	28.82%	NA
Indica III	913	66.40%	0.10%	11.06%	22.45%	NA
Indica Intermediate	786	57.00%	0.50%	18.45%	24.05%	NA
Temperate Japonica	767	93.10%	2.30%	0.52%	4.04%	NA
Tropical Japonica	504	36.30%	58.10%	0.00%	5.56%	NA
Japonica Intermediate	241	36.90%	50.20%	0.41%	12.45%	NA
VI/Aromatic	96	8.30%	87.50%	2.08%	2.08%	NA
Intermediate	90	51.10%	25.60%	5.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813419843	C -> T	LOC_Os08g22260.1	synonymous_variant ; p.Thr560Thr; LOW	synonymous_codon	Average:11.555; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0813419843	C -> DEL	LOC_Os08g22260.1	N	frameshift_variant	Average:11.555; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813419843	NA	7.14E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	2.16E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	2.27E-06	3.74E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	7.65E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	3.20E-06	NA	mr1571	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	9.40E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	1.37E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	2.20E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	5.42E-07	1.53E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	2.10E-08	2.10E-08	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	9.29E-07	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813419843	NA	1.26E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251