\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813416008:

Variant ID: vg0813416008 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13416008
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGCAAAAAGGGTGGCGATGC[G/A]
CCAAGATTGTATTGAACGTATGTATCCACTGATTACATGGGGTTCGGGGTCTATTTATACCCGAAAATTACAGACTATGTCCATATCGGACACGACTCTT

Reverse complement sequence

AAGAGTCGTGTCCGATATGGACATAGTCTGTAATTTTCGGGTATAAATAGACCCCGAACCCCATGTAATCAGTGGATACATACGTTCAATACAATCTTGG[C/T]
GCATCGCCACCCTTTTTGCTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 7.30% 12.80% 46.72% NA
All Indica  2759 5.70% 9.80% 19.54% 64.95% NA
All Japonica  1512 84.10% 4.40% 0.33% 11.11% NA
Aus  269 2.20% 1.50% 20.45% 75.84% NA
Indica I  595 5.00% 2.90% 10.92% 81.18% NA
Indica II  465 6.50% 4.90% 21.72% 66.88% NA
Indica III  913 3.80% 17.30% 23.22% 55.64% NA
Indica Intermediate  786 7.90% 9.30% 20.48% 62.34% NA
Temperate Japonica  767 86.80% 8.10% 0.26% 4.82% NA
Tropical Japonica  504 81.90% 0.20% 0.20% 17.66% NA
Japonica Intermediate  241 80.10% 1.70% 0.83% 17.43% NA
VI/Aromatic  96 88.50% 0.00% 1.04% 10.42% NA
Intermediate  90 53.30% 3.30% 5.56% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813416008 G -> A LOC_Os08g22260.1 upstream_gene_variant ; 1247.0bp to feature; MODIFIER silent_mutation Average:9.72; most accessible tissue: Callus, score: 16.801 N N N N
vg0813416008 G -> A LOC_Os08g22270.1 downstream_gene_variant ; 4582.0bp to feature; MODIFIER silent_mutation Average:9.72; most accessible tissue: Callus, score: 16.801 N N N N
vg0813416008 G -> A LOC_Os08g22250-LOC_Os08g22260 intergenic_region ; MODIFIER silent_mutation Average:9.72; most accessible tissue: Callus, score: 16.801 N N N N
vg0813416008 G -> DEL N N silent_mutation Average:9.72; most accessible tissue: Callus, score: 16.801 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813416008 NA 1.35E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 8.12E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 6.90E-06 2.78E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 7.65E-06 7.65E-06 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 8.18E-07 NA mr1406 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 5.38E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 5.78E-08 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 5.95E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 1.43E-06 6.66E-09 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 9.80E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 5.86E-08 5.86E-08 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 5.95E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 8.53E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 5.06E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813416008 NA 4.96E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251