\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813412700:

Variant ID: vg0813412700 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13412700
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTCAAATGCCCATTTTAACCGGATTCCTAAGTTTGTAAAGGTATTTGAATAATAAACCTCATAAAATGATAACCATGCATCTTTCTATTACTGTTGA[T/C]
GGTCCTTAAATCATAATATCTGACCGCCAATACCTGCATATACGGAATAAAATATGGTATTCAACTTAGTGGTATGGTTTATTACTAATCATTTCCACTA

Reverse complement sequence

TAGTGGAAATGATTAGTAATAAACCATACCACTAAGTTGAATACCATATTTTATTCCGTATATGCAGGTATTGGCGGTCAGATATTATGATTTAAGGACC[A/G]
TCAACAGTAATAGAAAGATGCATGGTTATCATTTTATGAGGTTTATTATTCAAATACCTTTACAAACTTAGGAATCCGGTTAAAATGGGCATTTGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.00% 19.80% 0.30% 58.91% NA
All Indica  2759 10.50% 2.80% 0.47% 86.15% NA
All Japonica  1512 37.80% 55.40% 0.00% 6.81% NA
Aus  269 1.50% 0.40% 0.00% 98.14% NA
Indica I  595 3.00% 4.90% 0.34% 91.76% NA
Indica II  465 6.50% 3.40% 0.43% 89.68% NA
Indica III  913 17.50% 0.50% 0.22% 81.71% NA
Indica Intermediate  786 10.60% 3.60% 0.89% 84.99% NA
Temperate Japonica  767 11.00% 84.20% 0.00% 4.82% NA
Tropical Japonica  504 70.20% 23.80% 0.00% 5.95% NA
Japonica Intermediate  241 55.60% 29.50% 0.00% 14.94% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 35.60% 23.30% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813412700 T -> C LOC_Os08g22260.1 upstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:9.011; most accessible tissue: Callus, score: 40.467 N N N N
vg0813412700 T -> C LOC_Os08g22250.1 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:9.011; most accessible tissue: Callus, score: 40.467 N N N N
vg0813412700 T -> C LOC_Os08g22250-LOC_Os08g22260 intergenic_region ; MODIFIER silent_mutation Average:9.011; most accessible tissue: Callus, score: 40.467 N N N N
vg0813412700 T -> DEL N N silent_mutation Average:9.011; most accessible tissue: Callus, score: 40.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813412700 NA 1.35E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 2.24E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 2.98E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 5.26E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 2.91E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 4.55E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 7.62E-06 mr1514 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 1.78E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 3.33E-06 9.13E-07 mr1838 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 3.36E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 2.23E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 1.13E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 2.20E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 1.48E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 5.84E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 1.17E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700 NA 1.80E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251