Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813412700:

Variant ID: vg0813412700 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13412700
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTCAAATGCCCATTTTAACCGGATTCCTAAGTTTGTAAAGGTATTTGAATAATAAACCTCATAAAATGATAACCATGCATCTTTCTATTACTGTTGA[T/C]
GGTCCTTAAATCATAATATCTGACCGCCAATACCTGCATATACGGAATAAAATATGGTATTCAACTTAGTGGTATGGTTTATTACTAATCATTTCCACTA

Reverse complement sequence

TAGTGGAAATGATTAGTAATAAACCATACCACTAAGTTGAATACCATATTTTATTCCGTATATGCAGGTATTGGCGGTCAGATATTATGATTTAAGGACC[A/G]
TCAACAGTAATAGAAAGATGCATGGTTATCATTTTATGAGGTTTATTATTCAAATACCTTTACAAACTTAGGAATCCGGTTAAAATGGGCATTTGAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.00%	19.80%	0.30%	58.91%	NA
All Indica	2759	10.50%	2.80%	0.47%	86.15%	NA
All Japonica	1512	37.80%	55.40%	0.00%	6.81%	NA
Aus	269	1.50%	0.40%	0.00%	98.14%	NA
Indica I	595	3.00%	4.90%	0.34%	91.76%	NA
Indica II	465	6.50%	3.40%	0.43%	89.68%	NA
Indica III	913	17.50%	0.50%	0.22%	81.71%	NA
Indica Intermediate	786	10.60%	3.60%	0.89%	84.99%	NA
Temperate Japonica	767	11.00%	84.20%	0.00%	4.82%	NA
Tropical Japonica	504	70.20%	23.80%	0.00%	5.95%	NA
Japonica Intermediate	241	55.60%	29.50%	0.00%	14.94%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	35.60%	23.30%	1.11%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813412700	T -> C	LOC_Os08g22260.1	upstream_gene_variant ; 4555.0bp to feature; MODIFIER	silent_mutation	Average:9.011; most accessible tissue: Callus, score: 40.467	N	N	N	N
vg0813412700	T -> C	LOC_Os08g22250.1	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:9.011; most accessible tissue: Callus, score: 40.467	N	N	N	N
vg0813412700	T -> C	LOC_Os08g22250-LOC_Os08g22260	intergenic_region ; MODIFIER	silent_mutation	Average:9.011; most accessible tissue: Callus, score: 40.467	N	N	N	N
vg0813412700	T -> DEL	N	N	silent_mutation	Average:9.011; most accessible tissue: Callus, score: 40.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813412700	NA	1.35E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	2.24E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	2.98E-07	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	5.26E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	2.91E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	4.55E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	7.62E-06	mr1514	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	1.78E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	3.33E-06	9.13E-07	mr1838	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	3.36E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	2.23E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	1.13E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	2.20E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	1.48E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	5.84E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	1.17E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813412700	NA	1.80E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251