\
| Variant ID: vg0813352775 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13352775 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 281. )
GTTGAACAGTGGATGGTTAATATTGATGAATTATTACAGCTGTTTTACTGCTTTCAACTACCGTCTTTAAATGCTCGCTTTATGCAAATGAACCGCTCTA[A/G]
CTATCCTTTGATTATACCCTGCATCATACCCCTATTCCGGTATGACTTGCTGAGTACGGTGGTTGTACTCAGTCTTGCTCTATTTTCCCCAAAACCCCTA
TAGGGGTTTTGGGGAAAATAGAGCAAGACTGAGTACAACCACCGTACTCAGCAAGTCATACCGGAATAGGGGTATGATGCAGGGTATAATCAAAGGATAG[T/C]
TAGAGCGGTTCATTTGCATAAAGCGAGCATTTAAAGACGGTAGTTGAAAGCAGTAAAACAGCTGTAATAATTCATCAATATTAACCATCCACTGTTCAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.10% | 19.80% | 0.06% | 12.06% | NA |
| All Indica | 2759 | 98.20% | 1.70% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 11.80% | 57.20% | 0.13% | 30.89% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 13.00% | 84.70% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 8.50% | 26.40% | 0.00% | 65.08% | NA |
| Japonica Intermediate | 241 | 14.50% | 34.00% | 0.83% | 50.62% | NA |
| VI/Aromatic | 96 | 14.60% | 1.00% | 1.04% | 83.33% | NA |
| Intermediate | 90 | 55.60% | 22.20% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813352775 | A -> G | LOC_Os08g22130.1 | upstream_gene_variant ; 1704.0bp to feature; MODIFIER | silent_mutation | Average:61.248; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| vg0813352775 | A -> G | LOC_Os08g22130-LOC_Os08g22149 | intergenic_region ; MODIFIER | silent_mutation | Average:61.248; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| vg0813352775 | A -> DEL | N | N | silent_mutation | Average:61.248; most accessible tissue: Minghui63 flag leaf, score: 81.312 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813352775 | NA | 1.47E-31 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 9.83E-08 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 2.92E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 5.60E-08 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 8.66E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 3.19E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | 4.06E-06 | 1.84E-07 | mr1296 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 7.36E-08 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 9.90E-28 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 3.54E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 4.02E-08 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 2.19E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 7.40E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813352775 | NA | 2.34E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |