Search for Variation information by Variation ID:
Detailed information for vg0813336261:
| Variant ID: vg0813336261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13336261 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGTAGAGCATTTGTCCCAGGTATTGACAGCAGCAAGGTTGGCATAGAACCACTGCTTCGCTCTCCCGAGAAGGAGAACGGAAACAGTCGCAGCCTGACGG[T/C]
GTCGGGACTGACACCCTTGATGGTGTACGTGCTACAGATCTCTAGGAACTGTTGCAGATGAGCATTGGCATCCTCATCAGGCTTGCCACAGAACGGGCTA
Reverse complement sequence
TAGCCCGTTCTGTGGCAAGCCTGATGAGGATGCCAATGCTCATCTGCAACAGTTCCTAGAGATCTGTAGCACGTACACCATCAAGGGTGTCAGTCCCGAC[A/G]
CCGTCAGGCTGCGACTGTTTCCGTTCTCCTTCTCGGGAGAGCGAAGCAGTGGTTCTATGCCAACCTTGCTGCTGTCAATACCTGGGACAAATGCTCTACG
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 11.60% | 7.41% | 22.26% | NA |
| All Indica | 2759 | 51.60% | 8.90% | 8.84% | 30.70% | NA |
| All Japonica | 1512 | 77.80% | 4.40% | 5.62% | 12.17% | NA |
| Aus | 269 | 16.70% | 79.90% | 1.12% | 2.23% | NA |
| Indica I | 595 | 40.80% | 2.20% | 11.60% | 45.38% | NA |
| Indica II | 465 | 55.70% | 3.20% | 8.82% | 32.26% | NA |
| Indica III | 913 | 59.10% | 15.20% | 6.13% | 19.50% | NA |
| Indica Intermediate | 786 | 48.50% | 9.90% | 9.92% | 31.68% | NA |
| Temperate Japonica | 767 | 89.60% | 0.30% | 2.87% | 7.30% | NA |
| Tropical Japonica | 504 | 66.50% | 11.10% | 8.53% | 13.89% | NA |
| Japonica Intermediate | 241 | 63.90% | 3.70% | 8.30% | 24.07% | NA |
| VI/Aromatic | 96 | 70.80% | 11.50% | 11.46% | 6.25% | NA |
| Intermediate | 90 | 72.20% | 10.00% | 7.78% | 10.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813336261 | T -> C | LOC_Os08g22080.1 | missense_variant ; p.Thr38Ala; MODERATE | nonsynonymous_codon ; T38V | Average:8.984; most accessible tissue: Minghui63 root, score: 13.235 | benign  |
-0.005 |
TOLERATED | 0.08 |
| vg0813336261 | T -> C | LOC_Os08g22080.1 | missense_variant ; p.Thr38Ala; MODERATE | nonsynonymous_codon ; T38A | Average:8.984; most accessible tissue: Minghui63 root, score: 13.235 | benign |
-0.577 |
TOLERATED | 1.00 |
| vg0813336261 | T -> DEL | LOC_Os08g22080.1 | N | frameshift_variant | Average:8.984; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813336261 | NA | 9.39E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 9.49E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | 4.68E-06 | 4.67E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 1.53E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 5.66E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | 7.66E-06 | 7.56E-09 | mr1200_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 3.01E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 1.70E-06 | mr1403_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 3.80E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 5.40E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 1.43E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813336261 | NA | 9.93E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |