\
| Variant ID: vg0813244317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13244317 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAAAACAGTAAAACTGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAAAGCAACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACA[A/G,C]
TGCATTGAGTCGATTTATTAAGGTGGGACTAATCACGGTGAATCTGGTCGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTTTACTCTGATCAG
CTGATCAGAGTAAAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCGACCAGATTCACCGTGATTAGTCCCACCTTAATAAATCGACTCAATGCA[T/C,G]
TGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTTGCTTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACAGTTTTACTGTTTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.10% | 20.80% | 34.62% | 11.66% | C: 1.76% |
| All Indica | 2759 | 42.90% | 3.70% | 50.16% | 0.25% | C: 2.97% |
| All Japonica | 1512 | 9.10% | 56.20% | 6.48% | 28.17% | NA |
| Aus | 269 | 43.10% | 2.60% | 45.35% | 8.92% | NA |
| Indica I | 595 | 38.50% | 6.20% | 53.28% | 0.00% | C: 2.02% |
| Indica II | 465 | 39.60% | 6.00% | 52.26% | 0.22% | C: 1.94% |
| Indica III | 913 | 49.10% | 1.10% | 44.69% | 0.22% | C: 4.93% |
| Indica Intermediate | 786 | 41.10% | 3.40% | 52.93% | 0.51% | C: 2.04% |
| Temperate Japonica | 767 | 8.60% | 85.80% | 3.78% | 1.83% | NA |
| Tropical Japonica | 504 | 10.30% | 19.80% | 9.92% | 59.92% | NA |
| Japonica Intermediate | 241 | 8.30% | 38.20% | 7.88% | 45.64% | NA |
| VI/Aromatic | 96 | 11.50% | 1.00% | 10.42% | 77.08% | NA |
| Intermediate | 90 | 25.60% | 26.70% | 24.44% | 22.22% | C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813244317 | A -> G | LOC_Os08g22018.1 | upstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> G | LOC_Os08g22022.1 | upstream_gene_variant ; 3645.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> G | LOC_Os08g22016.1 | downstream_gene_variant ; 537.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> G | LOC_Os08g22016-LOC_Os08g22018 | intergenic_region ; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> C | LOC_Os08g22018.1 | upstream_gene_variant ; 1136.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> C | LOC_Os08g22022.1 | upstream_gene_variant ; 3645.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> C | LOC_Os08g22016.1 | downstream_gene_variant ; 537.0bp to feature; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> C | LOC_Os08g22016-LOC_Os08g22018 | intergenic_region ; MODIFIER | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| vg0813244317 | A -> DEL | N | N | silent_mutation | Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813244317 | NA | 6.45E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813244317 | NA | 2.31E-06 | mr1912_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813244317 | NA | 7.65E-06 | mr1922_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |