Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813244317:

Variant ID: vg0813244317 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13244317
Reference Allele: A	Alternative Allele: G,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAAACAGTAAAACTGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAAAGCAACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACA[A/G,C]
TGCATTGAGTCGATTTATTAAGGTGGGACTAATCACGGTGAATCTGGTCGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTTTACTCTGATCAG

Reverse complement sequence

CTGATCAGAGTAAAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCGACCAGATTCACCGTGATTAGTCCCACCTTAATAAATCGACTCAATGCA[T/C,G]
TGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTTGCTTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACAGTTTTACTGTTTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.10%	20.80%	34.62%	11.66%	C: 1.76%
All Indica	2759	42.90%	3.70%	50.16%	0.25%	C: 2.97%
All Japonica	1512	9.10%	56.20%	6.48%	28.17%	NA
Aus	269	43.10%	2.60%	45.35%	8.92%	NA
Indica I	595	38.50%	6.20%	53.28%	0.00%	C: 2.02%
Indica II	465	39.60%	6.00%	52.26%	0.22%	C: 1.94%
Indica III	913	49.10%	1.10%	44.69%	0.22%	C: 4.93%
Indica Intermediate	786	41.10%	3.40%	52.93%	0.51%	C: 2.04%
Temperate Japonica	767	8.60%	85.80%	3.78%	1.83%	NA
Tropical Japonica	504	10.30%	19.80%	9.92%	59.92%	NA
Japonica Intermediate	241	8.30%	38.20%	7.88%	45.64%	NA
VI/Aromatic	96	11.50%	1.00%	10.42%	77.08%	NA
Intermediate	90	25.60%	26.70%	24.44%	22.22%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813244317	A -> G	LOC_Os08g22018.1	upstream_gene_variant ; 1136.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> G	LOC_Os08g22022.1	upstream_gene_variant ; 3645.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> G	LOC_Os08g22016.1	downstream_gene_variant ; 537.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> G	LOC_Os08g22016-LOC_Os08g22018	intergenic_region ; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> C	LOC_Os08g22018.1	upstream_gene_variant ; 1136.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> C	LOC_Os08g22022.1	upstream_gene_variant ; 3645.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> C	LOC_Os08g22016.1	downstream_gene_variant ; 537.0bp to feature; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> C	LOC_Os08g22016-LOC_Os08g22018	intergenic_region ; MODIFIER	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N
vg0813244317	A -> DEL	N	N	silent_mutation	Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813244317	NA	6.45E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813244317	NA	2.31E-06	mr1912_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813244317	NA	7.65E-06	mr1922_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251