\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813244317:

Variant ID: vg0813244317 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13244317
Reference Allele: AAlternative Allele: G,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAAACAGTAAAACTGTTGAGTAATTAAAGTAACATTAAATCTCCACTGATCAAAGCAACACCACGTTGAACAGGCCCAACCAACCCACCTGAACTACA[A/G,C]
TGCATTGAGTCGATTTATTAAGGTGGGACTAATCACGGTGAATCTGGTCGACCGCCCATAACCACGGGCACGGCTATTCGAATAGTTTTACTCTGATCAG

Reverse complement sequence

CTGATCAGAGTAAAACTATTCGAATAGCCGTGCCCGTGGTTATGGGCGGTCGACCAGATTCACCGTGATTAGTCCCACCTTAATAAATCGACTCAATGCA[T/C,G]
TGTAGTTCAGGTGGGTTGGTTGGGCCTGTTCAACGTGGTGTTGCTTTGATCAGTGGAGATTTAATGTTACTTTAATTACTCAACAGTTTTACTGTTTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.10% 20.80% 34.62% 11.66% C: 1.76%
All Indica  2759 42.90% 3.70% 50.16% 0.25% C: 2.97%
All Japonica  1512 9.10% 56.20% 6.48% 28.17% NA
Aus  269 43.10% 2.60% 45.35% 8.92% NA
Indica I  595 38.50% 6.20% 53.28% 0.00% C: 2.02%
Indica II  465 39.60% 6.00% 52.26% 0.22% C: 1.94%
Indica III  913 49.10% 1.10% 44.69% 0.22% C: 4.93%
Indica Intermediate  786 41.10% 3.40% 52.93% 0.51% C: 2.04%
Temperate Japonica  767 8.60% 85.80% 3.78% 1.83% NA
Tropical Japonica  504 10.30% 19.80% 9.92% 59.92% NA
Japonica Intermediate  241 8.30% 38.20% 7.88% 45.64% NA
VI/Aromatic  96 11.50% 1.00% 10.42% 77.08% NA
Intermediate  90 25.60% 26.70% 24.44% 22.22% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813244317 A -> G LOC_Os08g22018.1 upstream_gene_variant ; 1136.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> G LOC_Os08g22022.1 upstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> G LOC_Os08g22016.1 downstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> G LOC_Os08g22016-LOC_Os08g22018 intergenic_region ; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> C LOC_Os08g22018.1 upstream_gene_variant ; 1136.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> C LOC_Os08g22022.1 upstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> C LOC_Os08g22016.1 downstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> C LOC_Os08g22016-LOC_Os08g22018 intergenic_region ; MODIFIER silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N
vg0813244317 A -> DEL N N silent_mutation Average:28.771; most accessible tissue: Zhenshan97 flower, score: 46.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813244317 NA 6.45E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813244317 NA 2.31E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813244317 NA 7.65E-06 mr1922_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251