\
| Variant ID: vg0813207586 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13207586 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGAGGAATGTCGTAGAGCATTTGTCCCAGGTATTGACAGCAGCAAGGTTGGCATAGAACCACTGCTTCGCTCTCCCGAGAAGGAGAACGGAAACAGTCG[C/T]
AGCCTGACGGCGTCGGGACTGACACCCTTGATGGTGTACGTGCTACAGATCTCTAGGAACTGTTGCAGATGAGCATTGGCATCCTCATCAGGCTTGCCAC
GTGGCAAGCCTGATGAGGATGCCAATGCTCATCTGCAACAGTTCCTAGAGATCTGTAGCACGTACACCATCAAGGGTGTCAGTCCCGACGCCGTCAGGCT[G/A]
CGACTGTTTCCGTTCTCCTTCTCGGGAGAGCGAAGCAGTGGTTCTATGCCAACCTTGCTGCTGTCAATACCTGGGACAAATGCTCTACGACATTCCTCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 3.80% | 5.37% | 20.69% | NA |
| All Indica | 2759 | 61.80% | 5.40% | 6.71% | 26.17% | NA |
| All Japonica | 1512 | 82.60% | 1.80% | 3.17% | 12.43% | NA |
| Aus | 269 | 91.40% | 1.10% | 3.35% | 4.09% | NA |
| Indica I | 595 | 44.00% | 3.00% | 6.05% | 46.89% | NA |
| Indica II | 465 | 55.70% | 4.10% | 5.81% | 34.41% | NA |
| Indica III | 913 | 76.80% | 9.50% | 8.11% | 5.59% | NA |
| Indica Intermediate | 786 | 61.30% | 3.10% | 6.11% | 29.52% | NA |
| Temperate Japonica | 767 | 89.80% | 0.00% | 0.26% | 9.91% | NA |
| Tropical Japonica | 504 | 77.20% | 2.20% | 4.76% | 15.87% | NA |
| Japonica Intermediate | 241 | 71.00% | 6.60% | 9.13% | 13.28% | NA |
| VI/Aromatic | 96 | 55.20% | 1.00% | 8.33% | 35.42% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 4.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813207586 | C -> T | LOC_Os08g22006.1 | synonymous_variant ; p.Leu41Leu; LOW | synonymous_codon | Average:7.344; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| vg0813207586 | C -> DEL | LOC_Os08g22006.1 | N | frameshift_variant | Average:7.344; most accessible tissue: Minghui63 young leaf, score: 11.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813207586 | NA | 1.05E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 6.39E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 6.91E-06 | mr1484 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | 6.40E-06 | 7.93E-14 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | 1.24E-07 | 1.14E-07 | mr1609 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 3.55E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 8.47E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 7.65E-25 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 8.06E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | NA | 7.35E-13 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813207586 | 2.78E-07 | 2.78E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |