\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813117473:

Variant ID: vg0813117473 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13117473
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTTAGGTTCAACTGGCTGGTGCTTGCTGGTGCATGTAACTTAATAATCCGCGTCGCGTGTATGTTGAGCAAGGCGTTGCCGCCGCAAGTGCTGGTAGC[T/C]
AGCGGCGATTGGCGATGCGTACGGTGCACAGGATGCGCCAGCCATGCGTGGCCGCGATGTAGGCGCCGCAGACGAGCTCGAGTTTGCTTGGGCAGGGCAC

Reverse complement sequence

GTGCCCTGCCCAAGCAAACTCGAGCTCGTCTGCGGCGCCTACATCGCGGCCACGCATGGCTGGCGCATCCTGTGCACCGTACGCATCGCCAATCGCCGCT[A/G]
GCTACCAGCACTTGCGGCGGCAACGCCTTGCTCAACATACACGCGACGCGGATTATTAAGTTACATGCACCAGCAAGCACCAGCCAGTTGAACCTAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 22.40% 0.42% 15.68% NA
All Indica  2759 90.30% 0.70% 0.29% 8.70% NA
All Japonica  1512 12.60% 65.90% 0.46% 21.03% NA
Aus  269 56.10% 0.40% 1.86% 41.64% NA
Indica I  595 97.50% 0.70% 0.00% 1.85% NA
Indica II  465 92.00% 1.50% 0.86% 5.59% NA
Indica III  913 84.60% 0.30% 0.22% 14.90% NA
Indica Intermediate  786 90.60% 0.60% 0.25% 8.52% NA
Temperate Japonica  767 5.60% 85.40% 0.13% 8.87% NA
Tropical Japonica  504 21.00% 42.70% 0.99% 35.32% NA
Japonica Intermediate  241 17.00% 52.70% 0.41% 29.88% NA
VI/Aromatic  96 20.80% 17.70% 0.00% 61.46% NA
Intermediate  90 57.80% 28.90% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813117473 T -> C LOC_Os08g21890.1 upstream_gene_variant ; 3993.0bp to feature; MODIFIER silent_mutation Average:80.873; most accessible tissue: Zhenshan97 flag leaf, score: 90.842 N N N N
vg0813117473 T -> C LOC_Os08g21900.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:80.873; most accessible tissue: Zhenshan97 flag leaf, score: 90.842 N N N N
vg0813117473 T -> C LOC_Os08g21890-LOC_Os08g21900 intergenic_region ; MODIFIER silent_mutation Average:80.873; most accessible tissue: Zhenshan97 flag leaf, score: 90.842 N N N N
vg0813117473 T -> DEL N N silent_mutation Average:80.873; most accessible tissue: Zhenshan97 flag leaf, score: 90.842 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0813117473 T C -0.03 -0.01 -0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813117473 NA 6.61E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 2.03E-35 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 2.63E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 2.98E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 2.62E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 1.48E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 8.89E-29 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 3.05E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 4.09E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 1.88E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 7.19E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 1.54E-06 1.54E-06 mr1919_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813117473 NA 2.81E-06 mr1919_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251