Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0813113439:

Variant ID: vg0813113439 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13113439
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTCGGCTCCGCAAGGTCAAGAGCAAGCCCGGCAGCCGGTTCCCTTGCGTCGAAGACCCCGGGAAGCCCGTCGTCGCCGTCAACTCGAAGTTCGCCGTC[G/A]
CGTTTTGATCTCCGGCAAGGCCTTGCTGCTCCTTCCGTCATCGCCAAGCTTTGCCGCAGCCTCCCTCGGCATCGCAGCTGCGAAGTGAACCTCGTCCACC

Reverse complement sequence

GGTGGACGAGGTTCACTTCGCAGCTGCGATGCCGAGGGAGGCTGCGGCAAAGCTTGGCGATGACGGAAGGAGCAGCAAGGCCTTGCCGGAGATCAAAACG[C/T]
GACGGCGAACTTCGAGTTGACGGCGACGACGGGCTTCCCGGGGTCTTCGACGCAAGGGAACCGGCTGCCGGGCTTGCTCTTGACCTTGCGGAGCCGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 5.70% 0.47% 8.76% NA
All Indica  2759 97.00% 1.40% 0.04% 1.49% NA
All Japonica  1512 78.60% 0.30% 0.53% 20.63% NA
Aus  269 19.00% 81.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.00% 0.50% NA
Indica II  465 99.60% 0.00% 0.00% 0.43% NA
Indica III  913 95.80% 1.00% 0.00% 3.18% NA
Indica Intermediate  786 95.00% 3.90% 0.13% 0.89% NA
Temperate Japonica  767 93.40% 0.00% 0.00% 6.65% NA
Tropical Japonica  504 53.60% 0.60% 1.19% 44.64% NA
Japonica Intermediate  241 83.80% 0.40% 0.83% 14.94% NA
VI/Aromatic  96 30.20% 4.20% 11.46% 54.17% NA
Intermediate  90 82.20% 5.60% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813113439 G -> A LOC_Os08g21890.1 synonymous_variant ; p.Arg14Arg; LOW synonymous_codon Average:77.149; most accessible tissue: Zhenshan97 flag leaf, score: 93.175 N N N N
vg0813113439 G -> A LOC_Os08g21890.1 synonymous_variant ; p.Arg14Arg; LOW nonsynonymous_codon ; R14H Average:77.149; most accessible tissue: Zhenshan97 flag leaf, score: 93.175 unknown unknown TOLERATED 0.30
vg0813113439 G -> DEL LOC_Os08g21890.1 N frameshift_variant Average:77.149; most accessible tissue: Zhenshan97 flag leaf, score: 93.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0813113439 G A 0.0 -0.01 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813113439 3.60E-06 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251