\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813089324:

Variant ID: vg0813089324 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13089324
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGTCAAGGAGGCTCTGATACCAACTTGTCACGACCGGAAATCACCCAACGGGCGTTCCTTGCGTGCGTGTATTATTCCTTGTCCCAGGAGGCAAGGTA[T/C]
ACCAAAAGTTGATACAATACAGAGTTTAACAAGCGGAAGCGTAAATAGATAATTTATTACATGGGCTGCGAAGGCCCAGCACACATGAAGACAAACGAAA

Reverse complement sequence

TTTCGTTTGTCTTCATGTGTGCTGGGCCTTCGCAGCCCATGTAATAAATTATCTATTTACGCTTCCGCTTGTTAAACTCTGTATTGTATCAACTTTTGGT[A/G]
TACCTTGCCTCCTGGGACAAGGAATAATACACGCACGCAAGGAACGCCCGTTGGGTGATTTCCGGTCGTGACAAGTTGGTATCAGAGCCTCCTTGACCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.80% 27.30% 32.90% 0.02% NA
All Indica  2759 25.60% 30.20% 44.15% 0.04% NA
All Japonica  1512 73.50% 11.30% 15.15% 0.00% NA
Aus  269 3.00% 87.70% 9.29% 0.00% NA
Indica I  595 11.30% 22.70% 66.05% 0.00% NA
Indica II  465 27.30% 22.80% 49.89% 0.00% NA
Indica III  913 36.50% 39.30% 24.10% 0.11% NA
Indica Intermediate  786 22.90% 29.60% 47.46% 0.00% NA
Temperate Japonica  767 87.20% 8.10% 4.69% 0.00% NA
Tropical Japonica  504 62.70% 16.90% 20.44% 0.00% NA
Japonica Intermediate  241 52.70% 10.00% 37.34% 0.00% NA
VI/Aromatic  96 18.80% 30.20% 51.04% 0.00% NA
Intermediate  90 38.90% 23.30% 37.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813089324 T -> C LOC_Os08g21860.1 intron_variant ; MODIFIER silent_mutation Average:17.677; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0813089324 T -> DEL N N silent_mutation Average:17.677; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813089324 NA 3.54E-10 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.76E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.16E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 6.27E-07 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 8.94E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.43E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 6.18E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.65E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.90E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 1.76E-07 5.31E-10 mr1247 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.84E-12 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.05E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 5.31E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.49E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.99E-09 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.29E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.56E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 2.79E-06 8.62E-11 mr1120_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.76E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.75E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.05E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 3.12E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 7.12E-07 7.02E-11 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 5.13E-06 2.05E-07 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.40E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.01E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 2.40E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.04E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.44E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 5.61E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813089324 NA 1.66E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251