Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813088028:

Variant ID: vg0813088028 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13088028
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGCTGCCATGGTTGTTGTGGTTGCTGCCTTCGGGGTGACTGCCCTCACCGGTAGCAGCGCTTCTCCTGGTTGTCACCATCTGAAAATCCCACACAGAA[G/C]
CAGCAAACAGAGAGAGCTGACTATTAAAACTAACCACCCATGACTACCATAATTCTTGAATTTATTTCTGCTATTAAATTGGTTCATTAAGGTTCAAGTT

Reverse complement sequence

AACTTGAACCTTAATGAACCAATTTAATAGCAGAAATAAATTCAAGAATTATGGTAGTCATGGGTGGTTAGTTTTAATAGTCAGCTCTCTCTGTTTGCTG[C/G]
TTCTGTGTGGGATTTTCAGATGGTGACAACCAGGAGAAGCGCTGCTACCGGTGAGGGCAGTCACCCCGAAGGCAGCAACCACAACAACCATGGCAGCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	33.50%	2.62%	0.91%	NA
All Indica	2759	83.90%	12.00%	2.65%	1.49%	NA
All Japonica	1512	31.40%	65.40%	3.11%	0.07%	NA
Aus	269	16.70%	82.90%	0.00%	0.37%	NA
Indica I	595	89.90%	7.10%	2.02%	1.01%	NA
Indica II	465	87.30%	7.50%	4.95%	0.22%	NA
Indica III	913	80.20%	16.10%	0.99%	2.74%	NA
Indica Intermediate	786	81.70%	13.50%	3.69%	1.15%	NA
Temperate Japonica	767	4.70%	93.00%	2.22%	0.13%	NA
Tropical Japonica	504	60.70%	36.30%	2.98%	0.00%	NA
Japonica Intermediate	241	55.20%	38.60%	6.22%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	61.10%	34.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813088028	G -> C	LOC_Os08g21860.1	intron_variant ; MODIFIER	silent_mutation	Average:15.854; most accessible tissue: Callus, score: 22.327	N	N	N	N
vg0813088028	G -> DEL	N	N	silent_mutation	Average:15.854; most accessible tissue: Callus, score: 22.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813088028	NA	1.39E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	2.24E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	2.83E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	8.92E-07	NA	mr1067	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	5.83E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	4.70E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	9.49E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	3.95E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.25E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	8.16E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	6.09E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	4.12E-06	mr1358	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	3.32E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	6.63E-07	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	2.19E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	8.66E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	9.42E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.60E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.82E-11	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	2.28E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.49E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	2.44E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	6.76E-06	6.76E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.29E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	3.67E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	8.57E-08	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028	NA	1.90E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251