\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813088028:

Variant ID: vg0813088028 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13088028
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCTGCCATGGTTGTTGTGGTTGCTGCCTTCGGGGTGACTGCCCTCACCGGTAGCAGCGCTTCTCCTGGTTGTCACCATCTGAAAATCCCACACAGAA[G/C]
CAGCAAACAGAGAGAGCTGACTATTAAAACTAACCACCCATGACTACCATAATTCTTGAATTTATTTCTGCTATTAAATTGGTTCATTAAGGTTCAAGTT

Reverse complement sequence

AACTTGAACCTTAATGAACCAATTTAATAGCAGAAATAAATTCAAGAATTATGGTAGTCATGGGTGGTTAGTTTTAATAGTCAGCTCTCTCTGTTTGCTG[C/G]
TTCTGTGTGGGATTTTCAGATGGTGACAACCAGGAGAAGCGCTGCTACCGGTGAGGGCAGTCACCCCGAAGGCAGCAACCACAACAACCATGGCAGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 33.50% 2.62% 0.91% NA
All Indica  2759 83.90% 12.00% 2.65% 1.49% NA
All Japonica  1512 31.40% 65.40% 3.11% 0.07% NA
Aus  269 16.70% 82.90% 0.00% 0.37% NA
Indica I  595 89.90% 7.10% 2.02% 1.01% NA
Indica II  465 87.30% 7.50% 4.95% 0.22% NA
Indica III  913 80.20% 16.10% 0.99% 2.74% NA
Indica Intermediate  786 81.70% 13.50% 3.69% 1.15% NA
Temperate Japonica  767 4.70% 93.00% 2.22% 0.13% NA
Tropical Japonica  504 60.70% 36.30% 2.98% 0.00% NA
Japonica Intermediate  241 55.20% 38.60% 6.22% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 61.10% 34.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813088028 G -> C LOC_Os08g21860.1 intron_variant ; MODIFIER silent_mutation Average:15.854; most accessible tissue: Callus, score: 22.327 N N N N
vg0813088028 G -> DEL N N silent_mutation Average:15.854; most accessible tissue: Callus, score: 22.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813088028 NA 1.39E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 2.24E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 2.83E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 8.92E-07 NA mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 5.83E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 4.70E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 9.49E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 3.95E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.25E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 8.16E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 6.09E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 4.12E-06 mr1358 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 3.32E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 6.63E-07 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 2.19E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 8.66E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 9.42E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.60E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.82E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 2.28E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.49E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 2.44E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 6.76E-06 6.76E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.29E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 3.67E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 8.57E-08 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813088028 NA 1.90E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251