Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813085446:

Variant ID: vg0813085446 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13085446
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGGCATAGGCTACCACATGACCTTCCTGCATTAATACGCACCCCAATCCTTGGCGCGAAGCGTCACAGTACACCAGGAAGTCCTTGCGAGTATCCGGTA[T/G,A]
GATTAGCACTGGCGAGGAAACCAGCTTTTCTTTGAGAGTTTGGAATGCTTTCTCGCATTGAGGGCTCCACACAAATTTTTCTTCCTTCTTCAGCAACTGC

Reverse complement sequence

GCAGTTGCTGAAGAAGGAAGAAAAATTTGTGTGGAGCCCTCAATGCGAGAAAGCATTCCAAACTCTCAAAGAAAAGCTGGTTTCCTCGCCAGTGCTAATC[A/C,T]
TACCGGATACTCGCAAGGACTTCCTGGTGTACTGTGACGCTTCGCGCCAAGGATTGGGGTGCGTATTAATGCAGGAAGGTCATGTGGTAGCCTATGCCTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.60%	1.60%	28.78%	22.94%	G: 0.04%
All Indica	2759	14.50%	2.40%	46.43%	36.64%	G: 0.07%
All Japonica	1512	94.20%	0.10%	2.71%	2.91%	NA
Aus	269	84.40%	2.20%	8.92%	4.46%	NA
Indica I	595	6.90%	2.20%	42.18%	48.74%	NA
Indica II	465	10.50%	2.20%	42.15%	45.16%	NA
Indica III	913	20.30%	3.50%	53.89%	22.23%	G: 0.11%
Indica Intermediate	786	15.90%	1.30%	43.51%	39.19%	G: 0.13%
Temperate Japonica	767	95.40%	0.00%	1.83%	2.74%	NA
Tropical Japonica	504	94.60%	0.40%	2.78%	2.18%	NA
Japonica Intermediate	241	89.60%	0.00%	5.39%	4.98%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	64.40%	3.30%	14.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813085446	T -> G	LOC_Os08g21860.1	missense_variant ; p.Ile1081Leu; MODERATE	nonsynonymous_codon ; I1081L	Average:8.943; most accessible tissue: Callus, score: 23.207	possibly damaging	-1.545	TOLERATED	1.00
vg0813085446	T -> A	LOC_Os08g21860.1	missense_variant ; p.Ile1081Leu; MODERATE	nonsynonymous_codon ; I1081L	Average:8.943; most accessible tissue: Callus, score: 23.207	possibly damaging	-1.545	TOLERATED	1.00
vg0813085446	T -> DEL	LOC_Os08g21860.1	N	frameshift_variant	Average:8.943; most accessible tissue: Callus, score: 23.207	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813085446	9.50E-06	NA	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	8.22E-06	NA	mr1203	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	9.27E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	3.83E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	2.98E-06	4.63E-08	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.86E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	3.85E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	2.24E-29	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	2.12E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	5.61E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	7.36E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	7.36E-06	7.36E-06	mr1566	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.72E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	2.92E-06	3.21E-06	mr1619	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.05E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	5.62E-26	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	7.15E-06	1.61E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	6.59E-25	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.46E-13	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	1.41E-08	1.41E-08	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.61E-13	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.93E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	6.59E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813085446	NA	1.32E-06	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251