\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812798828:

Variant ID: vg0812798828 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12798828
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTGCTTGGTTTCACATCGTTTCTTAGAGCTGATATCCAGATAGCGCGAACTAGTCCTCTTGTATGCCATGGTTAGAAAAAAAATCAACGTTTCACCC[A/G]
TTCAACCCATGATCAAGCAATGGTTAGAAAATGTGAAGTTGTCTGGTCCTGTTGAGTGTATTTCTTTGGTGACTCGTTTAGCATGAAGAGTTGGGACTAT

Reverse complement sequence

ATAGTCCCAACTCTTCATGCTAAACGAGTCACCAAAGAAATACACTCAACAGGACCAGACAACTTCACATTTTCTAACCATTGCTTGATCATGGGTTGAA[T/C]
GGGTGAAACGTTGATTTTTTTTCTAACCATGGCATACAAGAGGACTAGTTCGCGCTATCTGGATATCAGCTCTAAGAAACGATGTGAAACCAAGCAACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 12.00% 1.27% 57.13% NA
All Indica  2759 13.40% 0.60% 1.96% 83.98% NA
All Japonica  1512 65.20% 28.80% 0.00% 5.95% NA
Aus  269 3.30% 0.40% 1.49% 94.80% NA
Indica I  595 8.60% 0.00% 2.69% 88.74% NA
Indica II  465 9.70% 0.60% 2.15% 87.53% NA
Indica III  913 17.90% 0.80% 1.31% 80.07% NA
Indica Intermediate  786 14.20% 0.90% 2.04% 82.82% NA
Temperate Japonica  767 92.70% 2.70% 0.00% 4.56% NA
Tropical Japonica  504 36.10% 58.10% 0.00% 5.75% NA
Japonica Intermediate  241 38.60% 50.60% 0.00% 10.79% NA
VI/Aromatic  96 7.30% 88.50% 1.04% 3.12% NA
Intermediate  90 31.10% 28.90% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812798828 A -> G LOC_Os08g21474.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:19.711; most accessible tissue: Callus, score: 27.968 N N N N
vg0812798828 A -> G LOC_Os08g21480.1 upstream_gene_variant ; 3916.0bp to feature; MODIFIER silent_mutation Average:19.711; most accessible tissue: Callus, score: 27.968 N N N N
vg0812798828 A -> G LOC_Os08g21470.1 downstream_gene_variant ; 2244.0bp to feature; MODIFIER silent_mutation Average:19.711; most accessible tissue: Callus, score: 27.968 N N N N
vg0812798828 A -> G LOC_Os08g21470-LOC_Os08g21474 intergenic_region ; MODIFIER silent_mutation Average:19.711; most accessible tissue: Callus, score: 27.968 N N N N
vg0812798828 A -> DEL N N silent_mutation Average:19.711; most accessible tissue: Callus, score: 27.968 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812798828 3.14E-07 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798828 NA 7.14E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798828 NA 5.85E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812798828 NA 3.50E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251