\
| Variant ID: vg0812798828 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12798828 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 159. )
AAGTTGCTTGGTTTCACATCGTTTCTTAGAGCTGATATCCAGATAGCGCGAACTAGTCCTCTTGTATGCCATGGTTAGAAAAAAAATCAACGTTTCACCC[A/G]
TTCAACCCATGATCAAGCAATGGTTAGAAAATGTGAAGTTGTCTGGTCCTGTTGAGTGTATTTCTTTGGTGACTCGTTTAGCATGAAGAGTTGGGACTAT
ATAGTCCCAACTCTTCATGCTAAACGAGTCACCAAAGAAATACACTCAACAGGACCAGACAACTTCACATTTTCTAACCATTGCTTGATCATGGGTTGAA[T/C]
GGGTGAAACGTTGATTTTTTTTCTAACCATGGCATACAAGAGGACTAGTTCGCGCTATCTGGATATCAGCTCTAAGAAACGATGTGAAACCAAGCAACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 12.00% | 1.27% | 57.13% | NA |
| All Indica | 2759 | 13.40% | 0.60% | 1.96% | 83.98% | NA |
| All Japonica | 1512 | 65.20% | 28.80% | 0.00% | 5.95% | NA |
| Aus | 269 | 3.30% | 0.40% | 1.49% | 94.80% | NA |
| Indica I | 595 | 8.60% | 0.00% | 2.69% | 88.74% | NA |
| Indica II | 465 | 9.70% | 0.60% | 2.15% | 87.53% | NA |
| Indica III | 913 | 17.90% | 0.80% | 1.31% | 80.07% | NA |
| Indica Intermediate | 786 | 14.20% | 0.90% | 2.04% | 82.82% | NA |
| Temperate Japonica | 767 | 92.70% | 2.70% | 0.00% | 4.56% | NA |
| Tropical Japonica | 504 | 36.10% | 58.10% | 0.00% | 5.75% | NA |
| Japonica Intermediate | 241 | 38.60% | 50.60% | 0.00% | 10.79% | NA |
| VI/Aromatic | 96 | 7.30% | 88.50% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 31.10% | 28.90% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812798828 | A -> G | LOC_Os08g21474.1 | upstream_gene_variant ; 184.0bp to feature; MODIFIER | silent_mutation | Average:19.711; most accessible tissue: Callus, score: 27.968 | N | N | N | N |
| vg0812798828 | A -> G | LOC_Os08g21480.1 | upstream_gene_variant ; 3916.0bp to feature; MODIFIER | silent_mutation | Average:19.711; most accessible tissue: Callus, score: 27.968 | N | N | N | N |
| vg0812798828 | A -> G | LOC_Os08g21470.1 | downstream_gene_variant ; 2244.0bp to feature; MODIFIER | silent_mutation | Average:19.711; most accessible tissue: Callus, score: 27.968 | N | N | N | N |
| vg0812798828 | A -> G | LOC_Os08g21470-LOC_Os08g21474 | intergenic_region ; MODIFIER | silent_mutation | Average:19.711; most accessible tissue: Callus, score: 27.968 | N | N | N | N |
| vg0812798828 | A -> DEL | N | N | silent_mutation | Average:19.711; most accessible tissue: Callus, score: 27.968 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812798828 | 3.14E-07 | NA | mr1566 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798828 | NA | 7.14E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798828 | NA | 5.85E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812798828 | NA | 3.50E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |