Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812793667:

Variant ID: vg0812793667 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12793667
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTAAGGCTGAGATTAAACGTTTATATGATGCTGGTTTTATTCGTCCTTGCCGATATGCTGAGTGGGTTTCTAGCATAGTTCCTGTTATCAAGATAAA[C/T]
GGCAAAGTAAGGGTGTGCATTGATTTCAATGATTTAAACAAGGCTACCCCAAAAGATGAGTATCTGTTGATGGTCGTTATTGACCAATTTCAACCGTCAA

Reverse complement sequence

TTGACGGTTGAAATTGGTCAATAACGACCATCAACAGATACTCATCTTTTGGGGTAGCCTTGTTTAAATCATTGAAATCAATGCACACCCTTACTTTGCC[G/A]
TTTATCTTGATAACAGGAACTATGCTAGAAACCCACTCAGCATATCGGCAAGGACGAATAAAACCAGCATCATATAAACGTTTAATCTCAGCCTTAACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.00%	8.90%	5.84%	50.32%	NA
All Indica	2759	8.30%	9.70%	7.29%	74.77%	NA
All Japonica	1512	84.90%	9.10%	0.20%	5.89%	NA
Aus	269	2.20%	1.10%	26.02%	70.63%	NA
Indica I	595	15.10%	2.40%	3.03%	79.50%	NA
Indica II	465	9.70%	4.90%	8.60%	76.77%	NA
Indica III	913	1.50%	17.30%	7.45%	73.71%	NA
Indica Intermediate	786	10.10%	9.20%	9.54%	71.25%	NA
Temperate Japonica	767	87.00%	8.30%	0.26%	4.43%	NA
Tropical Japonica	504	81.90%	12.30%	0.00%	5.75%	NA
Japonica Intermediate	241	84.20%	4.60%	0.41%	10.79%	NA
VI/Aromatic	96	88.50%	7.30%	1.04%	3.12%	NA
Intermediate	90	56.70%	5.60%	1.11%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812793667	C -> T	LOC_Os08g21460.1	synonymous_variant ; p.Asn865Asn; LOW	synonymous_codon	Average:15.371; most accessible tissue: Callus, score: 30.072	N	N	N	N
vg0812793667	C -> DEL	LOC_Os08g21460.1	N	frameshift_variant	Average:15.371; most accessible tissue: Callus, score: 30.072	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812793667	NA	5.33E-08	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	4.15E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	9.87E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	1.55E-06	9.61E-20	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	8.25E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	2.12E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	7.38E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	8.32E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	4.31E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	2.17E-06	6.30E-23	mr1362_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	1.06E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	8.19E-06	mr1405_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	3.21E-13	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	5.44E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	4.03E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	2.11E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	2.72E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	6.95E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	6.11E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	2.11E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	4.91E-15	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	6.76E-06	mr1713_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	8.49E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	3.90E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	9.72E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	2.60E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	1.29E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812793667	NA	7.34E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251