Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812791309:

Variant ID: vg0812791309 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12791309
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAGGCCTTGAGGGTTAGGTTGTTTCCTTTGTCTTTGTCTGGATGTGCTTTTACTTGGTTTTCTTCTTTGCCATATGGATCAATCAACAGCTGGGCCGA[T/C]
TTGGAGAAGCAATTCCATAGTTACTTTTATAGCGGGGTTCACGAGATGAAATTGTCTGATTTAACAACGATTAGGCAGAGGCATGATGAGCCTGTGCAGG

Reverse complement sequence

CCTGCACAGGCTCATCATGCCTCTGCCTAATCGTTGTTAAATCAGACAATTTCATCTCGTGAACCCCGCTATAAAAGTAACTATGGAATTGCTTCTCCAA[A/G]
TCGGCCCAGCTGTTGATTGATCCATATGGCAAAGAAGAAAACCAAGTAAAAGCACATCCAGACAAAGACAAAGGAAACAACCTAACCCTCAAGGCCTCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	14.70%	9.56%	4.78%	NA
All Indica	2759	57.70%	25.10%	14.68%	2.46%	NA
All Japonica	1512	95.40%	0.10%	0.99%	3.57%	NA
Aus	269	53.50%	0.40%	8.55%	37.55%	NA
Indica I	595	38.30%	30.10%	30.76%	0.84%	NA
Indica II	465	76.60%	12.50%	10.54%	0.43%	NA
Indica III	913	60.00%	28.70%	7.01%	4.27%	NA
Indica Intermediate	786	58.70%	24.70%	13.87%	2.80%	NA
Temperate Japonica	767	96.30%	0.00%	1.17%	2.48%	NA
Tropical Japonica	504	94.80%	0.00%	0.79%	4.37%	NA
Japonica Intermediate	241	93.40%	0.40%	0.83%	5.39%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	86.70%	2.20%	7.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812791309	T -> C	LOC_Os08g21470.1	upstream_gene_variant ; 4443.0bp to feature; MODIFIER	silent_mutation	Average:12.382; most accessible tissue: Callus, score: 34.751	N	N	N	N
vg0812791309	T -> C	LOC_Os08g21460.1	intron_variant ; MODIFIER	silent_mutation	Average:12.382; most accessible tissue: Callus, score: 34.751	N	N	N	N
vg0812791309	T -> DEL	N	N	silent_mutation	Average:12.382; most accessible tissue: Callus, score: 34.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812791309	NA	3.65E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	NA	1.15E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	NA	5.04E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	NA	5.19E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	NA	1.53E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	NA	1.53E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	1.18E-08	2.25E-13	mr1846_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812791309	3.58E-08	2.26E-22	mr1846_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251