\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812783415:

Variant ID: vg0812783415 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12783415
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTCATATCTTGAAGAAATTTATTCTACACTAACCTTTACTCAGGGACGAGCAAAGGGCTAAGTGTGGGGGGTTGTCACGACCGGAAATAACCCAAC[G/A]
GGCGTTCCTTACGTGCGTGCATTATTCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTGATACAATTCAGAGTTTAACAAGCGGAAGCGTAATTAATTA

Reverse complement sequence

TAATTAATTACGCTTCCGCTTGTTAAACTCTGAATTGTATCAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGAATAATGCACGCACGTAAGGAACGCC[C/T]
GTTGGGTTATTTCCGGTCGTGACAACCCCCCACACTTAGCCCTTTGCTCGTCCCTGAGTAAAGGTTAGTGTAGAATAAATTTCTTCAAGATATGAATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 6.50% 0.95% 10.03% NA
All Indica  2759 90.80% 8.70% 0.43% 0.07% NA
All Japonica  1512 68.50% 4.30% 1.19% 26.06% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 95.10% 4.70% 0.00% 0.22% NA
Indica III  913 83.50% 15.70% 0.77% 0.11% NA
Indica Intermediate  786 91.60% 8.00% 0.38% 0.00% NA
Temperate Japonica  767 89.80% 8.00% 0.39% 1.83% NA
Tropical Japonica  504 44.80% 0.20% 2.18% 52.78% NA
Japonica Intermediate  241 49.80% 1.20% 1.66% 47.30% NA
VI/Aromatic  96 24.00% 1.00% 10.42% 64.58% NA
Intermediate  90 76.70% 1.10% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812783415 G -> A LOC_Os08g21450.1 upstream_gene_variant ; 2146.0bp to feature; MODIFIER silent_mutation Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0812783415 G -> A LOC_Os08g21434.1 downstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0812783415 G -> A LOC_Os08g21434-LOC_Os08g21450 intergenic_region ; MODIFIER silent_mutation Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0812783415 G -> DEL N N silent_mutation Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812783415 NA 6.77E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 7.63E-07 7.63E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 5.18E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 6.13E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 1.60E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 3.50E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 4.86E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 8.05E-06 8.04E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 7.27E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 2.84E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 1.10E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812783415 NA 1.93E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251