\
| Variant ID: vg0812783415 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12783415 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 295. )
TTGATTCATATCTTGAAGAAATTTATTCTACACTAACCTTTACTCAGGGACGAGCAAAGGGCTAAGTGTGGGGGGTTGTCACGACCGGAAATAACCCAAC[G/A]
GGCGTTCCTTACGTGCGTGCATTATTCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTGATACAATTCAGAGTTTAACAAGCGGAAGCGTAATTAATTA
TAATTAATTACGCTTCCGCTTGTTAAACTCTGAATTGTATCAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGAATAATGCACGCACGTAAGGAACGCC[C/T]
GTTGGGTTATTTCCGGTCGTGACAACCCCCCACACTTAGCCCTTTGCTCGTCCCTGAGTAAAGGTTAGTGTAGAATAAATTTCTTCAAGATATGAATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 6.50% | 0.95% | 10.03% | NA |
| All Indica | 2759 | 90.80% | 8.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 68.50% | 4.30% | 1.19% | 26.06% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.00% | 0.22% | NA |
| Indica III | 913 | 83.50% | 15.70% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 91.60% | 8.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 89.80% | 8.00% | 0.39% | 1.83% | NA |
| Tropical Japonica | 504 | 44.80% | 0.20% | 2.18% | 52.78% | NA |
| Japonica Intermediate | 241 | 49.80% | 1.20% | 1.66% | 47.30% | NA |
| VI/Aromatic | 96 | 24.00% | 1.00% | 10.42% | 64.58% | NA |
| Intermediate | 90 | 76.70% | 1.10% | 4.44% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812783415 | G -> A | LOC_Os08g21450.1 | upstream_gene_variant ; 2146.0bp to feature; MODIFIER | silent_mutation | Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0812783415 | G -> A | LOC_Os08g21434.1 | downstream_gene_variant ; 1126.0bp to feature; MODIFIER | silent_mutation | Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0812783415 | G -> A | LOC_Os08g21434-LOC_Os08g21450 | intergenic_region ; MODIFIER | silent_mutation | Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0812783415 | G -> DEL | N | N | silent_mutation | Average:42.859; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812783415 | NA | 6.77E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | 7.63E-07 | 7.63E-07 | mr1369 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 5.18E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 6.13E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 1.60E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 3.50E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 4.86E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | 8.05E-06 | 8.04E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 7.27E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 2.84E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 1.10E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812783415 | NA | 1.93E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |