Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812764718:

Variant ID: vg0812764718 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12764718
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

CTCAAAATACCTGCATACACATATTTCACCAACACTAGTGGAAATGATTAGTAATAATACCTACCACTAAGTTGGATACCATGTTTTATTTCATTATATG[C/T]
AGGTATTGACGGTCAGATATTATGATTTAAGGACCGTCAACAACACCCCCACACTTAACCTTTTCTCGTCCCGAGTGAAGGCTATGAACTCTACAACAGA

Reverse complement sequence

TCTGTTGTAGAGTTCATAGCCTTCACTCGGGACGAGAAAAGGTTAAGTGTGGGGGTGTTGTTGACGGTCCTTAAATCATAATATCTGACCGTCAATACCT[G/A]
CATATAATGAAATAAAACATGGTATCCAACTTAGTGGTAGGTATTATTACTAATCATTTCCACTAGTGTTGGTGAAATATGTGTATGCAGGTATTTTGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	8.70%	1.48%	0.00%	NA
All Indica	2759	99.60%	0.10%	0.33%	0.00%	NA
All Japonica	1512	69.50%	26.70%	3.77%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.10%	0.76%	0.00%	NA
Temperate Japonica	767	51.50%	41.50%	7.04%	0.00%	NA
Tropical Japonica	504	92.30%	7.70%	0.00%	0.00%	NA
Japonica Intermediate	241	79.30%	19.50%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812764718	C -> T	LOC_Os08g21400.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0812764718	C -> T	LOC_Os08g21380.1	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0812764718	C -> T	LOC_Os08g21410.1	upstream_gene_variant ; 3038.0bp to feature; MODIFIER	silent_mutation	Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0812764718	C -> T	LOC_Os08g21390.1	downstream_gene_variant ; 1416.0bp to feature; MODIFIER	silent_mutation	Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812764718	4.04E-06	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	5.16E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	4.53E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	1.14E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	4.47E-06	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	NA	7.57E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	1.97E-08	NA	mr1618	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	NA	6.72E-07	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	NA	4.39E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	2.46E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	3.23E-08	NA	mr1203_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812764718	NA	1.52E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251