\
| Variant ID: vg0812764718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12764718 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
CTCAAAATACCTGCATACACATATTTCACCAACACTAGTGGAAATGATTAGTAATAATACCTACCACTAAGTTGGATACCATGTTTTATTTCATTATATG[C/T]
AGGTATTGACGGTCAGATATTATGATTTAAGGACCGTCAACAACACCCCCACACTTAACCTTTTCTCGTCCCGAGTGAAGGCTATGAACTCTACAACAGA
TCTGTTGTAGAGTTCATAGCCTTCACTCGGGACGAGAAAAGGTTAAGTGTGGGGGTGTTGTTGACGGTCCTTAAATCATAATATCTGACCGTCAATACCT[G/A]
CATATAATGAAATAAAACATGGTATCCAACTTAGTGGTAGGTATTATTACTAATCATTTCCACTAGTGTTGGTGAAATATGTGTATGCAGGTATTTTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 8.70% | 1.48% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.10% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 69.50% | 26.70% | 3.77% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.10% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 51.50% | 41.50% | 7.04% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 19.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812764718 | C -> T | LOC_Os08g21400.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0812764718 | C -> T | LOC_Os08g21380.1 | upstream_gene_variant ; 4520.0bp to feature; MODIFIER | silent_mutation | Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0812764718 | C -> T | LOC_Os08g21410.1 | upstream_gene_variant ; 3038.0bp to feature; MODIFIER | silent_mutation | Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0812764718 | C -> T | LOC_Os08g21390.1 | downstream_gene_variant ; 1416.0bp to feature; MODIFIER | silent_mutation | Average:45.529; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812764718 | 4.04E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 5.16E-06 | NA | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 4.53E-06 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 1.14E-07 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 4.47E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | NA | 7.57E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 1.97E-08 | NA | mr1618 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | NA | 6.72E-07 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | NA | 4.39E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 2.46E-07 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | 3.23E-08 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812764718 | NA | 1.52E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |