Variant ID: vg0812698215 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 12698215 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAATTCCACTAAAAATCCTGTTAGCATATTTTGACACGTAGAATCCAAGAAAAATTCCACACGCCGATTCTGATTATTAACTGTATTTATTAATTTAGG[G/T]
TTTCTCTCTTGCCTTTAAACAAATAATTTCTTAAAACAATTTATCAATTGAATTTTTGCTAGGGAGAAGAACTTCAGGGCGTGACAAACCTACCCCCCTT
AAGGGGGGTAGGTTTGTCACGCCCTGAAGTTCTTCTCCCTAGCAAAAATTCAATTGATAAATTGTTTTAAGAAATTATTTGTTTAAAGGCAAGAGAGAAA[C/A]
CCTAAATTAATAAATACAGTTAATAATCAGAATCGGCGTGTGGAATTTTTCTTGGATTCTACGTGTCAAAATATGCTAACAGGATTTTTAGTGGAATTTT
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 87.20% | 10.90% | 0.47% | 1.40% | NA |
All Indica | 2759 | 98.90% | 0.10% | 0.33% | 0.58% | NA |
All Japonica | 1512 | 72.40% | 27.40% | 0.07% | 0.20% | NA |
Aus | 269 | 78.40% | 0.00% | 4.46% | 17.10% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.20% | 0.10% | 0.22% | 0.44% | NA |
Indica Intermediate | 786 | 97.30% | 0.30% | 0.89% | 1.53% | NA |
Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 43.30% | 56.30% | 0.20% | 0.20% | NA |
Japonica Intermediate | 241 | 52.30% | 46.90% | 0.00% | 0.83% | NA |
VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 78.90% | 20.00% | 0.00% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0812698215 | G -> T | LOC_Os08g21260.1 | downstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
vg0812698215 | G -> T | LOC_Os08g21280.1 | downstream_gene_variant ; 306.0bp to feature; MODIFIER | silent_mutation | Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
vg0812698215 | G -> T | LOC_Os08g21260-LOC_Os08g21280 | intergenic_region ; MODIFIER | silent_mutation | Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
vg0812698215 | G -> DEL | N | N | silent_mutation | Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0812698215 | 3.40E-07 | NA | Grain_width | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0812698215 | NA | 4.58E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 2.64E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 1.34E-12 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 1.18E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 9.97E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 1.28E-13 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 7.53E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 1.71E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 8.19E-08 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0812698215 | NA | 2.93E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |