Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812698215:

Variant ID: vg0812698215 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12698215
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATTCCACTAAAAATCCTGTTAGCATATTTTGACACGTAGAATCCAAGAAAAATTCCACACGCCGATTCTGATTATTAACTGTATTTATTAATTTAGG[G/T]
TTTCTCTCTTGCCTTTAAACAAATAATTTCTTAAAACAATTTATCAATTGAATTTTTGCTAGGGAGAAGAACTTCAGGGCGTGACAAACCTACCCCCCTT

Reverse complement sequence

AAGGGGGGTAGGTTTGTCACGCCCTGAAGTTCTTCTCCCTAGCAAAAATTCAATTGATAAATTGTTTTAAGAAATTATTTGTTTAAAGGCAAGAGAGAAA[C/A]
CCTAAATTAATAAATACAGTTAATAATCAGAATCGGCGTGTGGAATTTTTCTTGGATTCTACGTGTCAAAATATGCTAACAGGATTTTTAGTGGAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	10.90%	0.47%	1.40%	NA
All Indica	2759	98.90%	0.10%	0.33%	0.58%	NA
All Japonica	1512	72.40%	27.40%	0.07%	0.20%	NA
Aus	269	78.40%	0.00%	4.46%	17.10%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.20%	0.10%	0.22%	0.44%	NA
Indica Intermediate	786	97.30%	0.30%	0.89%	1.53%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	43.30%	56.30%	0.20%	0.20%	NA
Japonica Intermediate	241	52.30%	46.90%	0.00%	0.83%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812698215	G -> T	LOC_Os08g21260.1	downstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0812698215	G -> T	LOC_Os08g21280.1	downstream_gene_variant ; 306.0bp to feature; MODIFIER	silent_mutation	Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0812698215	G -> T	LOC_Os08g21260-LOC_Os08g21280	intergenic_region ; MODIFIER	silent_mutation	Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N
vg0812698215	G -> DEL	N	N	silent_mutation	Average:34.981; most accessible tissue: Minghui63 flag leaf, score: 50.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812698215	3.40E-07	NA	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0812698215	NA	4.58E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	2.64E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	1.34E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	1.18E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	9.97E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	1.28E-13	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	7.53E-09	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	1.71E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	8.19E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812698215	NA	2.93E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251