| Variant ID: vg0812694622 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12694622 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAGTTAATATTTAATTAATCATGCAATAATACAAGGTTCGTTTCGCGTGCCGGGGAGGAGGGGTTCCCAACCCCTTCTCCCGAACACAGCCTACACTG[C/T]
GTTCGGCAGCAGCAAATAGTGAGATTGTTTCGTTTTTCACGCACATGCTTCCCGAACTACTAAACATTATATTTTTTGCAAAAACATTCTATAGGGAAGT
ACTTCCCTATAGAATGTTTTTGCAAAAAATATAATGTTTAGTAGTTCGGGAAGCATGTGCGTGAAAAACGAAACAATCTCACTATTTGCTGCTGCCGAAC[G/A]
CAGTGTAGGCTGTGTTCGGGAGAAGGGGTTGGGAACCCCTCCTCCCCGGCACGCGAAACGAACCTTGTATTATTGCATGATTAATTAAATATTAACTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 5.20% | 1.12% | 51.42% | NA |
| All Indica | 2759 | 17.40% | 0.10% | 0.65% | 81.84% | NA |
| All Japonica | 1512 | 80.60% | 15.50% | 1.98% | 1.98% | NA |
| Aus | 269 | 57.20% | 0.00% | 0.74% | 42.01% | NA |
| Indica I | 595 | 7.10% | 0.00% | 0.17% | 92.77% | NA |
| Indica II | 465 | 15.90% | 0.20% | 1.08% | 82.80% | NA |
| Indica III | 913 | 23.00% | 0.10% | 0.44% | 76.45% | NA |
| Indica Intermediate | 786 | 19.60% | 0.10% | 1.02% | 79.26% | NA |
| Temperate Japonica | 767 | 96.50% | 1.20% | 0.00% | 2.35% | NA |
| Tropical Japonica | 504 | 54.00% | 40.10% | 4.76% | 1.19% | NA |
| Japonica Intermediate | 241 | 85.50% | 9.50% | 2.49% | 2.49% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 7.80% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812694622 | C -> T | LOC_Os08g21260.1 | upstream_gene_variant ; 705.0bp to feature; MODIFIER | silent_mutation | Average:13.823; most accessible tissue: Callus, score: 50.27 | N | N | N | N |
| vg0812694622 | C -> T | LOC_Os08g21280.1 | downstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:13.823; most accessible tissue: Callus, score: 50.27 | N | N | N | N |
| vg0812694622 | C -> T | LOC_Os08g21250-LOC_Os08g21260 | intergenic_region ; MODIFIER | silent_mutation | Average:13.823; most accessible tissue: Callus, score: 50.27 | N | N | N | N |
| vg0812694622 | C -> DEL | N | N | silent_mutation | Average:13.823; most accessible tissue: Callus, score: 50.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812694622 | NA | 4.89E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 2.19E-11 | mr1746 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 1.84E-14 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 3.44E-10 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 4.18E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 1.08E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 1.96E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812694622 | NA | 1.52E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |