Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812694622:

Variant ID: vg0812694622 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12694622
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAGTTAATATTTAATTAATCATGCAATAATACAAGGTTCGTTTCGCGTGCCGGGGAGGAGGGGTTCCCAACCCCTTCTCCCGAACACAGCCTACACTG[C/T]
GTTCGGCAGCAGCAAATAGTGAGATTGTTTCGTTTTTCACGCACATGCTTCCCGAACTACTAAACATTATATTTTTTGCAAAAACATTCTATAGGGAAGT

Reverse complement sequence

ACTTCCCTATAGAATGTTTTTGCAAAAAATATAATGTTTAGTAGTTCGGGAAGCATGTGCGTGAAAAACGAAACAATCTCACTATTTGCTGCTGCCGAAC[G/A]
CAGTGTAGGCTGTGTTCGGGAGAAGGGGTTGGGAACCCCTCCTCCCCGGCACGCGAAACGAACCTTGTATTATTGCATGATTAATTAAATATTAACTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	5.20%	1.12%	51.42%	NA
All Indica	2759	17.40%	0.10%	0.65%	81.84%	NA
All Japonica	1512	80.60%	15.50%	1.98%	1.98%	NA
Aus	269	57.20%	0.00%	0.74%	42.01%	NA
Indica I	595	7.10%	0.00%	0.17%	92.77%	NA
Indica II	465	15.90%	0.20%	1.08%	82.80%	NA
Indica III	913	23.00%	0.10%	0.44%	76.45%	NA
Indica Intermediate	786	19.60%	0.10%	1.02%	79.26%	NA
Temperate Japonica	767	96.50%	1.20%	0.00%	2.35%	NA
Tropical Japonica	504	54.00%	40.10%	4.76%	1.19%	NA
Japonica Intermediate	241	85.50%	9.50%	2.49%	2.49%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	60.00%	7.80%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812694622	C -> T	LOC_Os08g21260.1	upstream_gene_variant ; 705.0bp to feature; MODIFIER	silent_mutation	Average:13.823; most accessible tissue: Callus, score: 50.27	N	N	N	N
vg0812694622	C -> T	LOC_Os08g21280.1	downstream_gene_variant ; 3899.0bp to feature; MODIFIER	silent_mutation	Average:13.823; most accessible tissue: Callus, score: 50.27	N	N	N	N
vg0812694622	C -> T	LOC_Os08g21250-LOC_Os08g21260	intergenic_region ; MODIFIER	silent_mutation	Average:13.823; most accessible tissue: Callus, score: 50.27	N	N	N	N
vg0812694622	C -> DEL	N	N	silent_mutation	Average:13.823; most accessible tissue: Callus, score: 50.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812694622	NA	4.89E-09	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	2.19E-11	mr1746	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	1.84E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	3.44E-10	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	4.18E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	1.08E-06	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	1.96E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812694622	NA	1.52E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251