\
| Variant ID: vg0812659623 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12659623 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 213. )
TTATGCCCCATATGCCTTTGAGTAAGTTGTAATATATATGCACTAAGAGTATATACATATAATCATGGCTCGACTAACAATTTCGTTTGCAGCGACCATT[A/G]
GATAGTCTTTCTTCTCTATCCAAAGTACAATGAAGTCATCGTCTTGGATTCTCTCGACAAAGATAGCAACACCTATCAGGAATTTCTAAGAATTATCGAT
ATCGATAATTCTTAGAAATTCCTGATAGGTGTTGCTATCTTTGTCGAGAGAATCCAAGACGATGACTTCATTGTACTTTGGATAGAGAAGAAAGACTATC[T/C]
AATGGTCGCTGCAAACGAAATTGTTAGTCGAGCCATGATTATATGTATATACTCTTAGTGCATATATATTACAACTTACTCAAAGGCATATGGGGCATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 0.80% | 6.12% | 53.07% | NA |
| All Indica | 2759 | 23.70% | 1.10% | 8.34% | 66.91% | NA |
| All Japonica | 1512 | 67.50% | 0.00% | 0.86% | 31.68% | NA |
| Aus | 269 | 59.50% | 1.90% | 8.55% | 30.11% | NA |
| Indica I | 595 | 12.10% | 0.30% | 4.20% | 83.36% | NA |
| Indica II | 465 | 19.80% | 2.40% | 6.67% | 71.18% | NA |
| Indica III | 913 | 32.10% | 0.30% | 10.30% | 57.28% | NA |
| Indica Intermediate | 786 | 24.90% | 1.80% | 10.18% | 63.10% | NA |
| Temperate Japonica | 767 | 90.10% | 0.00% | 0.13% | 9.78% | NA |
| Tropical Japonica | 504 | 42.70% | 0.00% | 1.98% | 55.36% | NA |
| Japonica Intermediate | 241 | 47.30% | 0.00% | 0.83% | 51.87% | NA |
| VI/Aromatic | 96 | 14.60% | 4.20% | 19.79% | 61.46% | NA |
| Intermediate | 90 | 47.80% | 0.00% | 4.44% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812659623 | A -> G | LOC_Os08g21190.1 | upstream_gene_variant ; 4650.0bp to feature; MODIFIER | silent_mutation | Average:8.33; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0812659623 | A -> G | LOC_Os08g21210.1 | downstream_gene_variant ; 1894.0bp to feature; MODIFIER | silent_mutation | Average:8.33; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0812659623 | A -> G | LOC_Os08g21200.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.33; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0812659623 | A -> DEL | N | N | silent_mutation | Average:8.33; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812659623 | NA | 1.46E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 3.13E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 7.84E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 7.31E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | 5.73E-06 | 2.28E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 5.00E-06 | mr1483 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 3.15E-08 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 1.58E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 6.60E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 7.86E-13 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 9.97E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 3.11E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 1.32E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | NA | 5.77E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | 2.32E-06 | NA | mr1883 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659623 | 1.86E-07 | 1.86E-07 | mr1883 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |