\
| Variant ID: vg0812659243 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12659243 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTTCGATATGCATTCCCTCTACTGTAGGAAGCGGCTGGACGCCAATTTGATTGCCATCTGGTGTCTGTAAGTGCTACACTTGAACGTGTTAATAGATCA[T/C]
TACACCTATATGCGTAGCTCATTTGATCATCCATTGTGGCAGGATGAATTACGTGGAAGCCGAAGCGATGAAAAAGCCTGTCGCCTACCTAAACCCGTGC
GCACGGGTTTAGGTAGGCGACAGGCTTTTTCATCGCTTCGGCTTCCACGTAATTCATCCTGCCACAATGGATGATCAAATGAGCTACGCATATAGGTGTA[A/G]
TGATCTATTAACACGTTCAAGTGTAGCACTTACAGACACCAGATGGCAATCAAATTGGCGTCCAGCCGCTTCCTACAGTAGAGGGAATGCATATCGAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 1.20% | 12.25% | 47.84% | NA |
| All Indica | 2759 | 20.80% | 2.00% | 17.47% | 59.70% | NA |
| All Japonica | 1512 | 68.40% | 0.10% | 2.91% | 28.57% | NA |
| Aus | 269 | 60.20% | 0.00% | 10.04% | 29.74% | NA |
| Indica I | 595 | 12.80% | 0.80% | 13.28% | 73.11% | NA |
| Indica II | 465 | 18.70% | 3.20% | 16.99% | 61.08% | NA |
| Indica III | 913 | 25.50% | 1.40% | 20.59% | 52.46% | NA |
| Indica Intermediate | 786 | 22.80% | 2.80% | 17.30% | 57.12% | NA |
| Temperate Japonica | 767 | 90.60% | 0.00% | 0.65% | 8.74% | NA |
| Tropical Japonica | 504 | 43.70% | 0.40% | 6.55% | 49.40% | NA |
| Japonica Intermediate | 241 | 49.40% | 0.00% | 2.49% | 48.13% | NA |
| VI/Aromatic | 96 | 13.50% | 1.00% | 16.67% | 68.75% | NA |
| Intermediate | 90 | 47.80% | 1.10% | 11.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812659243 | T -> C | LOC_Os08g21200.1 | missense_variant ; p.Ile476Thr; MODERATE | nonsynonymous_codon ; I476T | Average:10.103; most accessible tissue: Callus, score: 42.328 | unknown | unknown | TOLERATED | 0.17 |
| vg0812659243 | T -> DEL | LOC_Os08g21200.1 | N | frameshift_variant | Average:10.103; most accessible tissue: Callus, score: 42.328 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812659243 | NA | 1.76E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 3.60E-08 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 1.78E-06 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 9.63E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 1.24E-07 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 2.65E-14 | mr1746 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 7.15E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 3.26E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 1.43E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | 7.49E-06 | 7.49E-06 | mr1883 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 9.32E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812659243 | NA | 1.87E-06 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |