\
| Variant ID: vg0812629955 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12629955 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )
GGATTGTATTACCAGTAGGAAGTTGAATCTGTTTCTCCCGAAGTAACAAATCAAAAATCTTATCAGCCTTGATGATATCAAAGTCATACCTCTCTTCTTT[T/C]
CCAGAACTCTTCACCCATTGGCATGGTATAACCTTCTTGTTTCTAACCCATTCGGCTGCTGCTATTTCGGAGTCGTCATCATCATCATCATCATCTGATC
GATCAGATGATGATGATGATGATGACGACTCCGAAATAGCAGCAGCCGAATGGGTTAGAAACAAGAAGGTTATACCATGCCAATGGGTGAAGAGTTCTGG[A/G]
AAAGAAGAGAGGTATGACTTTGATATCATCAAGGCTGATAAGATTTTTGATTTGTTACTTCGGGAGAAACAGATTCAACTTCCTACTGGTAATACAATCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 0.90% | 1.63% | 0.83% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.11% | 0.04% | NA |
| All Japonica | 1512 | 90.40% | 2.50% | 4.70% | 2.38% | NA |
| Aus | 269 | 98.50% | 0.40% | 0.74% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 76.40% | 5.80% | 11.11% | 6.75% | NA |
| Japonica Intermediate | 241 | 91.30% | 2.50% | 5.81% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812629955 | T -> C | LOC_Os08g21124.1 | synonymous_variant ; p.Gly292Gly; LOW | synonymous_codon | Average:48.222; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| vg0812629955 | T -> DEL | LOC_Os08g21124.1 | N | frameshift_variant | Average:48.222; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812629955 | 8.05E-07 | 2.69E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0812629955 | NA | 1.86E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 2.41E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 5.30E-07 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 2.22E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 8.20E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 3.39E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 7.74E-07 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | 4.11E-06 | 6.65E-13 | mr1905_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 3.41E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 9.36E-10 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812629955 | NA | 5.69E-06 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |