\
| Variant ID: vg0812591477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12591477 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.23, others allele: 0.00, population size: 90. )
GTTCTGAGATAACACAAGTGCTCTTAGTGGTGTCCAAGTGTTGAAATATTTTTAGGAGCTGTTTTTGAAAATGGCTCTACTCGGGACAGAGAGTCCCACC[T/C]
GGAGGTTCTGTCCGGAACTTCCTGGCACCAAGGTGAGGTTGAAAAATTTCATAAGTGCTGCCCAGAAGTTCCTGGCACTTTTACCCGGAAGCTCCTGGCA
TGCCAGGAGCTTCCGGGTAAAAGTGCCAGGAACTTCTGGGCAGCACTTATGAAATTTTTCAACCTCACCTTGGTGCCAGGAAGTTCCGGACAGAACCTCC[A/G]
GGTGGGACTCTCTGTCCCGAGTAGAGCCATTTTCAAAAACAGCTCCTAAAAATATTTCAACACTTGGACACCACTAAGAGCACTTGTGTTATCTCAGAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 29.30% | 2.90% | 12.63% | NA |
| All Indica | 2759 | 76.70% | 11.30% | 4.42% | 7.50% | NA |
| All Japonica | 1512 | 12.30% | 66.90% | 0.66% | 20.17% | NA |
| Aus | 269 | 63.20% | 10.80% | 0.00% | 26.02% | NA |
| Indica I | 595 | 86.60% | 3.00% | 6.72% | 3.70% | NA |
| Indica II | 465 | 78.30% | 8.80% | 7.31% | 5.59% | NA |
| Indica III | 913 | 72.00% | 18.10% | 2.08% | 7.89% | NA |
| Indica Intermediate | 786 | 73.90% | 11.30% | 3.69% | 11.07% | NA |
| Temperate Japonica | 767 | 3.40% | 93.40% | 0.00% | 3.26% | NA |
| Tropical Japonica | 504 | 12.70% | 39.10% | 1.19% | 47.02% | NA |
| Japonica Intermediate | 241 | 39.80% | 40.70% | 1.66% | 17.84% | NA |
| VI/Aromatic | 96 | 89.60% | 4.20% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 53.30% | 31.10% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812591477 | T -> C | LOC_Os08g21060.1 | missense_variant ; p.Leu43Pro; MODERATE | nonsynonymous_codon ; L43S | Average:17.275; most accessible tissue: Callus, score: 26.397 | unknown | unknown | TOLERATED | 0.65 |
| vg0812591477 | T -> C | LOC_Os08g21060.1 | missense_variant ; p.Leu43Pro; MODERATE | nonsynonymous_codon ; L43P | Average:17.275; most accessible tissue: Callus, score: 26.397 | unknown | unknown | TOLERATED | 1.00 |
| vg0812591477 | T -> DEL | LOC_Os08g21060.1 | N | frameshift_variant | Average:17.275; most accessible tissue: Callus, score: 26.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812591477 | NA | 1.09E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 7.68E-06 | 9.69E-08 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 7.83E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 5.13E-08 | 5.13E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 2.43E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 3.79E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 9.00E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 3.43E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 3.78E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 7.16E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 1.48E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 7.53E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 4.60E-08 | 1.13E-21 | mr1900_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | NA | 3.66E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812591477 | 7.49E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |