Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812524957:

Variant ID: vg0812524957 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12524957
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCATTTATTGGTCTATGTCCAAATATAACTAAATCCATGACTTATAAATTATTTACATAAAGTTTAGCCTCAGATTTTGTGACTAAAATATGAACACA[C/T]
GTTGATGAGTCTTTAACTTGTTTATGAGAGATAATAGCAGAGCTTGTATGATTAAATCACCAATATGAAATTAATTAACGACATTTCCTATACACTAGTA

Reverse complement sequence

TACTAGTGTATAGGAAATGTCGTTAATTAATTTCATATTGGTGATTTAATCATACAAGCTCTGCTATTATCTCTCATAAACAAGTTAAAGACTCATCAAC[G/A]
TGTGTTCATATTTTAGTCACAAAATCTGAGGCTAAACTTTATGTAAATAATTTATAAGTCATGGATTTAGTTATATTTGGACATAGACCAATAAATGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	6.70%	0.70%	2.54%	NA
All Indica	2759	97.10%	0.10%	0.14%	2.65%	NA
All Japonica	1512	81.10%	14.60%	1.72%	2.58%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	0.00%	0.22%	2.37%	NA
Indica III	913	96.20%	0.00%	0.11%	3.72%	NA
Indica Intermediate	786	95.90%	0.30%	0.25%	3.56%	NA
Temperate Japonica	767	96.30%	1.20%	0.91%	1.56%	NA
Tropical Japonica	504	71.80%	22.20%	3.17%	2.78%	NA
Japonica Intermediate	241	51.90%	41.50%	1.24%	5.39%	NA
VI/Aromatic	96	11.50%	83.30%	2.08%	3.12%	NA
Intermediate	90	80.00%	14.40%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812524957	C -> T	LOC_Os08g20885.1	upstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:47.126; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0812524957	C -> T	LOC_Os08g20870.1	downstream_gene_variant ; 2818.0bp to feature; MODIFIER	silent_mutation	Average:47.126; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0812524957	C -> T	LOC_Os08g20870-LOC_Os08g20885	intergenic_region ; MODIFIER	silent_mutation	Average:47.126; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0812524957	C -> DEL	N	N	silent_mutation	Average:47.126; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812524957	NA	1.30E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	5.15E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	1.33E-06	3.18E-08	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	3.94E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	1.36E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	4.94E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	1.75E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	1.67E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	1.73E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	3.25E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812524957	NA	2.65E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251