\
| Variant ID: vg0812498626 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12498626 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACCGAGGGCCAGAACAACCGGCTGTTTTCTTTGCACCCCCAACCTCTGTCGGCAGTTCAGAACTTCATCAGATAGGACTGTTGTCACGTCCCAAAACGAC[C/T]
CTAAAATACATCCTCTAAATTATGCCTAGAATAATTAAAATCCGTGTGAAAGCCTCCAACAATTAAAATGTGCAAAGTTAAAAGTCAAATAAGGCTTGGA
TCCAAGCCTTATTTGACTTTTAACTTTGCACATTTTAATTGTTGGAGGCTTTCACACGGATTTTAATTATTCTAGGCATAATTTAGAGGATGTATTTTAG[G/A]
GTCGTTTTGGGACGTGACAACAGTCCTATCTGATGAAGTTCTGAACTGCCGACAGAGGTTGGGGGTGCAAAGAAAACAGCCGGTTGTTCTGGCCCTCGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.60% | 19.90% | 0.25% | 17.29% | NA |
| All Indica | 2759 | 89.10% | 1.60% | 0.33% | 8.99% | NA |
| All Japonica | 1512 | 11.50% | 57.40% | 0.00% | 31.08% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.60% | 1.80% | 0.50% | 2.02% | NA |
| Indica II | 465 | 89.90% | 2.40% | 0.65% | 7.10% | NA |
| Indica III | 913 | 84.20% | 0.40% | 0.00% | 15.33% | NA |
| Indica Intermediate | 786 | 89.20% | 2.40% | 0.38% | 8.02% | NA |
| Temperate Japonica | 767 | 5.10% | 85.30% | 0.00% | 9.65% | NA |
| Tropical Japonica | 504 | 19.40% | 25.80% | 0.00% | 54.76% | NA |
| Japonica Intermediate | 241 | 15.40% | 34.90% | 0.00% | 49.79% | NA |
| VI/Aromatic | 96 | 15.60% | 0.00% | 3.12% | 81.25% | NA |
| Intermediate | 90 | 50.00% | 27.80% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812498626 | C -> T | LOC_Os08g20820.1 | upstream_gene_variant ; 3049.0bp to feature; MODIFIER | silent_mutation | Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0812498626 | C -> T | LOC_Os08g20840.1 | upstream_gene_variant ; 2219.0bp to feature; MODIFIER | silent_mutation | Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0812498626 | C -> T | LOC_Os08g20830.1 | downstream_gene_variant ; 490.0bp to feature; MODIFIER | silent_mutation | Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0812498626 | C -> T | LOC_Os08g20830-LOC_Os08g20840 | intergenic_region ; MODIFIER | silent_mutation | Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg0812498626 | C -> DEL | N | N | silent_mutation | Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812498626 | NA | 1.18E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | NA | 1.16E-06 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | 3.27E-06 | 3.27E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | NA | 3.02E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | NA | 5.48E-15 | mr1595_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | NA | 3.89E-11 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812498626 | NA | 1.12E-06 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |