\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812498626:

Variant ID: vg0812498626 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12498626
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGAGGGCCAGAACAACCGGCTGTTTTCTTTGCACCCCCAACCTCTGTCGGCAGTTCAGAACTTCATCAGATAGGACTGTTGTCACGTCCCAAAACGAC[C/T]
CTAAAATACATCCTCTAAATTATGCCTAGAATAATTAAAATCCGTGTGAAAGCCTCCAACAATTAAAATGTGCAAAGTTAAAAGTCAAATAAGGCTTGGA

Reverse complement sequence

TCCAAGCCTTATTTGACTTTTAACTTTGCACATTTTAATTGTTGGAGGCTTTCACACGGATTTTAATTATTCTAGGCATAATTTAGAGGATGTATTTTAG[G/A]
GTCGTTTTGGGACGTGACAACAGTCCTATCTGATGAAGTTCTGAACTGCCGACAGAGGTTGGGGGTGCAAAGAAAACAGCCGGTTGTTCTGGCCCTCGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 19.90% 0.25% 17.29% NA
All Indica  2759 89.10% 1.60% 0.33% 8.99% NA
All Japonica  1512 11.50% 57.40% 0.00% 31.08% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 95.60% 1.80% 0.50% 2.02% NA
Indica II  465 89.90% 2.40% 0.65% 7.10% NA
Indica III  913 84.20% 0.40% 0.00% 15.33% NA
Indica Intermediate  786 89.20% 2.40% 0.38% 8.02% NA
Temperate Japonica  767 5.10% 85.30% 0.00% 9.65% NA
Tropical Japonica  504 19.40% 25.80% 0.00% 54.76% NA
Japonica Intermediate  241 15.40% 34.90% 0.00% 49.79% NA
VI/Aromatic  96 15.60% 0.00% 3.12% 81.25% NA
Intermediate  90 50.00% 27.80% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812498626 C -> T LOC_Os08g20820.1 upstream_gene_variant ; 3049.0bp to feature; MODIFIER silent_mutation Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0812498626 C -> T LOC_Os08g20840.1 upstream_gene_variant ; 2219.0bp to feature; MODIFIER silent_mutation Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0812498626 C -> T LOC_Os08g20830.1 downstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0812498626 C -> T LOC_Os08g20830-LOC_Os08g20840 intergenic_region ; MODIFIER silent_mutation Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N
vg0812498626 C -> DEL N N silent_mutation Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812498626 NA 1.18E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 NA 1.16E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 3.27E-06 3.27E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 NA 3.02E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 NA 5.48E-15 mr1595_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 NA 3.89E-11 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626 NA 1.12E-06 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251