Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812498626:

Variant ID: vg0812498626 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12498626
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCGAGGGCCAGAACAACCGGCTGTTTTCTTTGCACCCCCAACCTCTGTCGGCAGTTCAGAACTTCATCAGATAGGACTGTTGTCACGTCCCAAAACGAC[C/T]
CTAAAATACATCCTCTAAATTATGCCTAGAATAATTAAAATCCGTGTGAAAGCCTCCAACAATTAAAATGTGCAAAGTTAAAAGTCAAATAAGGCTTGGA

Reverse complement sequence

TCCAAGCCTTATTTGACTTTTAACTTTGCACATTTTAATTGTTGGAGGCTTTCACACGGATTTTAATTATTCTAGGCATAATTTAGAGGATGTATTTTAG[G/A]
GTCGTTTTGGGACGTGACAACAGTCCTATCTGATGAAGTTCTGAACTGCCGACAGAGGTTGGGGGTGCAAAGAAAACAGCCGGTTGTTCTGGCCCTCGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	19.90%	0.25%	17.29%	NA
All Indica	2759	89.10%	1.60%	0.33%	8.99%	NA
All Japonica	1512	11.50%	57.40%	0.00%	31.08%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	95.60%	1.80%	0.50%	2.02%	NA
Indica II	465	89.90%	2.40%	0.65%	7.10%	NA
Indica III	913	84.20%	0.40%	0.00%	15.33%	NA
Indica Intermediate	786	89.20%	2.40%	0.38%	8.02%	NA
Temperate Japonica	767	5.10%	85.30%	0.00%	9.65%	NA
Tropical Japonica	504	19.40%	25.80%	0.00%	54.76%	NA
Japonica Intermediate	241	15.40%	34.90%	0.00%	49.79%	NA
VI/Aromatic	96	15.60%	0.00%	3.12%	81.25%	NA
Intermediate	90	50.00%	27.80%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812498626	C -> T	LOC_Os08g20820.1	upstream_gene_variant ; 3049.0bp to feature; MODIFIER	silent_mutation	Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0812498626	C -> T	LOC_Os08g20840.1	upstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0812498626	C -> T	LOC_Os08g20830.1	downstream_gene_variant ; 490.0bp to feature; MODIFIER	silent_mutation	Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0812498626	C -> T	LOC_Os08g20830-LOC_Os08g20840	intergenic_region ; MODIFIER	silent_mutation	Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0812498626	C -> DEL	N	N	silent_mutation	Average:45.949; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812498626	NA	1.18E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	NA	1.16E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	3.27E-06	3.27E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	NA	3.02E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	NA	5.48E-15	mr1595_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	NA	3.89E-11	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812498626	NA	1.12E-06	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251