\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812486826:

Variant ID: vg0812486826 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12486826
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATTGTAGGAGAACTCGGCATAGGGGAGACTCTTATCCCAGGTCTTCCCAAAATCTAGAACACAGGCACGGAGCATATCTTCTAGGATCTGATTCAGA[T/C]
GCTCGGTCTGCACATCTGTTTGCGGGTGATACGCGGTGCTGAAATTTAATCGGGTACCCAACTCTTCTTGGAGCTTCTTCCAGAAGTGAGAGGTGAATTG

Reverse complement sequence

CAATTCACCTCTCACTTCTGGAAGAAGCTCCAAGAAGAGTTGGGTACCCGATTAAATTTCAGCACCGCGTATCACCCGCAAACAGATGTGCAGACCGAGC[A/G]
TCTGAATCAGATCCTAGAAGATATGCTCCGTGCCTGTGTTCTAGATTTTGGGAAGACCTGGGATAAGAGTCTCCCCTATGCCGAGTTCTCCTACAATAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.80% 4.70% 55.10% 20.40% NA
All Indica  2759 1.90% 6.90% 62.52% 28.74% NA
All Japonica  1512 56.80% 0.80% 38.96% 3.44% NA
Aus  269 0.70% 7.40% 55.76% 36.06% NA
Indica I  595 2.50% 4.90% 51.43% 41.18% NA
Indica II  465 2.40% 6.90% 57.42% 33.33% NA
Indica III  913 0.80% 7.70% 75.47% 16.10% NA
Indica Intermediate  786 2.40% 7.40% 58.91% 31.30% NA
Temperate Japonica  767 85.00% 0.00% 13.69% 1.30% NA
Tropical Japonica  504 24.40% 2.20% 69.64% 3.77% NA
Japonica Intermediate  241 34.90% 0.40% 55.19% 9.54% NA
VI/Aromatic  96 0.00% 1.00% 92.71% 6.25% NA
Intermediate  90 23.30% 2.20% 56.67% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812486826 T -> C LOC_Os08g20790.1 missense_variant ; p.His591Arg; MODERATE nonsynonymous_codon ; H591R Average:16.367; most accessible tissue: Minghui63 young leaf, score: 24.836 benign -0.501 TOLERATED 1.00
vg0812486826 T -> DEL LOC_Os08g20790.1 N frameshift_variant Average:16.367; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812486826 3.42E-06 2.08E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 NA 4.29E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 5.64E-06 2.24E-28 mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 3.88E-11 6.55E-15 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 6.70E-08 6.70E-08 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 NA 2.10E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 NA 1.08E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 5.36E-06 5.96E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812486826 NA 9.42E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251