Search for Variation information by Variation ID:
Detailed information for vg0812486826:
| Variant ID: vg0812486826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12486826 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 94. )
Flanking Sequence (100 bp) in Reference Genome:
GTTATTGTAGGAGAACTCGGCATAGGGGAGACTCTTATCCCAGGTCTTCCCAAAATCTAGAACACAGGCACGGAGCATATCTTCTAGGATCTGATTCAGA[T/C]
GCTCGGTCTGCACATCTGTTTGCGGGTGATACGCGGTGCTGAAATTTAATCGGGTACCCAACTCTTCTTGGAGCTTCTTCCAGAAGTGAGAGGTGAATTG
Reverse complement sequence
CAATTCACCTCTCACTTCTGGAAGAAGCTCCAAGAAGAGTTGGGTACCCGATTAAATTTCAGCACCGCGTATCACCCGCAAACAGATGTGCAGACCGAGC[A/G]
TCTGAATCAGATCCTAGAAGATATGCTCCGTGCCTGTGTTCTAGATTTTGGGAAGACCTGGGATAAGAGTCTCCCCTATGCCGAGTTCTCCTACAATAAC
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.80% | 4.70% | 55.10% | 20.40% | NA |
| All Indica | 2759 | 1.90% | 6.90% | 62.52% | 28.74% | NA |
| All Japonica | 1512 | 56.80% | 0.80% | 38.96% | 3.44% | NA |
| Aus | 269 | 0.70% | 7.40% | 55.76% | 36.06% | NA |
| Indica I | 595 | 2.50% | 4.90% | 51.43% | 41.18% | NA |
| Indica II | 465 | 2.40% | 6.90% | 57.42% | 33.33% | NA |
| Indica III | 913 | 0.80% | 7.70% | 75.47% | 16.10% | NA |
| Indica Intermediate | 786 | 2.40% | 7.40% | 58.91% | 31.30% | NA |
| Temperate Japonica | 767 | 85.00% | 0.00% | 13.69% | 1.30% | NA |
| Tropical Japonica | 504 | 24.40% | 2.20% | 69.64% | 3.77% | NA |
| Japonica Intermediate | 241 | 34.90% | 0.40% | 55.19% | 9.54% | NA |
| VI/Aromatic | 96 | 0.00% | 1.00% | 92.71% | 6.25% | NA |
| Intermediate | 90 | 23.30% | 2.20% | 56.67% | 17.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812486826 | T -> C | LOC_Os08g20790.1 | missense_variant ; p.His591Arg; MODERATE | nonsynonymous_codon ; H591R | Average:16.367; most accessible tissue: Minghui63 young leaf, score: 24.836 | benign  |
-0.501 |
TOLERATED | 1.00 |
| vg0812486826 | T -> DEL | LOC_Os08g20790.1 | N | frameshift_variant | Average:16.367; most accessible tissue: Minghui63 young leaf, score: 24.836 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812486826 | 3.42E-06 | 2.08E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | NA | 4.29E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | 5.64E-06 | 2.24E-28 | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | 3.88E-11 | 6.55E-15 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | 6.70E-08 | 6.70E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | NA | 2.10E-11 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | NA | 1.08E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | 5.36E-06 | 5.96E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812486826 | NA | 9.42E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |