\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812296238:

Variant ID: vg0812296238 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12296238
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTCCATTCTGAGATCTGCATTTTTTTCAAACAAATGTTAGTTCACAGCAATGAGTTTTTTATTAATAAGTTTGGAAAAATTTGTTGTTAATATTAC[C/G]
TCATAAGTATTGTGACTGCTGTTGTTGTAAATTTCATCAAATTCCTGGTAGTTCCATTCAATGCTTGGCAGTGCATGATTTGTTCCCAAGTTTGGGGAAA

Reverse complement sequence

TTTCCCCAAACTTGGGAACAAATCATGCACTGCCAAGCATTGAATGGAACTACCAGGAATTTGATGAAATTTACAACAACAGCAGTCACAATACTTATGA[G/C]
GTAATATTAACAACAAATTTTTCCAAACTTATTAATAAAAAACTCATTGCTGTGAACTAACATTTGTTTGAAAAAAATGCAGATCTCAGAATGGACAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 6.80% 1.57% 5.25% NA
All Indica  2759 99.60% 0.10% 0.04% 0.29% NA
All Japonica  1512 64.70% 18.60% 3.57% 13.10% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.00% 0.43% NA
Indica III  913 99.60% 0.10% 0.00% 0.33% NA
Indica Intermediate  786 99.40% 0.10% 0.13% 0.38% NA
Temperate Japonica  767 97.50% 2.20% 0.00% 0.26% NA
Tropical Japonica  504 22.60% 45.00% 5.36% 26.98% NA
Japonica Intermediate  241 48.50% 15.40% 11.20% 24.90% NA
VI/Aromatic  96 18.80% 29.20% 16.67% 35.42% NA
Intermediate  90 76.70% 11.10% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812296238 C -> G LOC_Os08g20480.1 downstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:30.122; most accessible tissue: Callus, score: 60.463 N N N N
vg0812296238 C -> G LOC_Os08g20486.1 intron_variant ; MODIFIER silent_mutation Average:30.122; most accessible tissue: Callus, score: 60.463 N N N N
vg0812296238 C -> DEL N N silent_mutation Average:30.122; most accessible tissue: Callus, score: 60.463 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812296238 NA 7.69E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.77E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 4.46E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.53E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.33E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.25E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 5.35E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 3.22E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 4.70E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 3.29E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.98E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.85E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 5.09E-06 mr1654 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.74E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 4.53E-06 2.15E-08 mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 5.45E-09 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.39E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.53E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.50E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 2.93E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.23E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 1.25E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 8.00E-15 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 5.69E-16 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238 NA 8.87E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251