Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812296238:

Variant ID: vg0812296238 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12296238
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGTCCATTCTGAGATCTGCATTTTTTTCAAACAAATGTTAGTTCACAGCAATGAGTTTTTTATTAATAAGTTTGGAAAAATTTGTTGTTAATATTAC[C/G]
TCATAAGTATTGTGACTGCTGTTGTTGTAAATTTCATCAAATTCCTGGTAGTTCCATTCAATGCTTGGCAGTGCATGATTTGTTCCCAAGTTTGGGGAAA

Reverse complement sequence

TTTCCCCAAACTTGGGAACAAATCATGCACTGCCAAGCATTGAATGGAACTACCAGGAATTTGATGAAATTTACAACAACAGCAGTCACAATACTTATGA[G/C]
GTAATATTAACAACAAATTTTTCCAAACTTATTAATAAAAAACTCATTGCTGTGAACTAACATTTGTTTGAAAAAAATGCAGATCTCAGAATGGACAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	6.80%	1.57%	5.25%	NA
All Indica	2759	99.60%	0.10%	0.04%	0.29%	NA
All Japonica	1512	64.70%	18.60%	3.57%	13.10%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	99.60%	0.10%	0.00%	0.33%	NA
Indica Intermediate	786	99.40%	0.10%	0.13%	0.38%	NA
Temperate Japonica	767	97.50%	2.20%	0.00%	0.26%	NA
Tropical Japonica	504	22.60%	45.00%	5.36%	26.98%	NA
Japonica Intermediate	241	48.50%	15.40%	11.20%	24.90%	NA
VI/Aromatic	96	18.80%	29.20%	16.67%	35.42%	NA
Intermediate	90	76.70%	11.10%	3.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812296238	C -> G	LOC_Os08g20480.1	downstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:30.122; most accessible tissue: Callus, score: 60.463	N	N	N	N
vg0812296238	C -> G	LOC_Os08g20486.1	intron_variant ; MODIFIER	silent_mutation	Average:30.122; most accessible tissue: Callus, score: 60.463	N	N	N	N
vg0812296238	C -> DEL	N	N	silent_mutation	Average:30.122; most accessible tissue: Callus, score: 60.463	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812296238	NA	7.69E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.77E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	4.46E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.53E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.33E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.25E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	5.35E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	3.22E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	4.70E-12	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	3.29E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.98E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.85E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	5.09E-06	mr1654	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.74E-09	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	4.53E-06	2.15E-08	mr1835	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	5.45E-09	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.39E-13	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.53E-08	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.50E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	2.93E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.23E-14	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	1.25E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	8.00E-15	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	5.69E-16	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812296238	NA	8.87E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251