\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812148045:

Variant ID: vg0812148045 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12148045
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCCGCTGGCCAATCTTTTTCCCGCTCCCGCGCCCCTCAGCTGGGCCCCCGCCCCTCACGGGTCACTGACAGGTGGGGCCCACCTGTCGGGCTCGTCTC[T/C]
TAGCACCGGCTGGCGCTGCCGCCCGCAACCACGCGCCGCAACCGCCGCTCTCGTGCCTCCCGCACCACTCCTCCACTTCCCCCACGCACGTCGCCCGCTC

Reverse complement sequence

GAGCGGGCGACGTGCGTGGGGGAAGTGGAGGAGTGGTGCGGGAGGCACGAGAGCGGCGGTTGCGGCGCGTGGTTGCGGGCGGCAGCGCCAGCCGGTGCTA[A/G]
GAGACGAGCCCGACAGGTGGGCCCCACCTGTCAGTGACCCGTGAGGGGCGGGGGCCCAGCTGAGGGGCGCGGGAGCGGGAAAAAGATTGGCCAGCGGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 23.50% 1.86% 3.43% NA
All Indica  2759 89.40% 9.60% 0.69% 0.33% NA
All Japonica  1512 34.70% 54.60% 1.26% 9.46% NA
Aus  269 82.20% 0.70% 17.10% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 93.50% 5.20% 1.08% 0.22% NA
Indica III  913 82.60% 16.50% 0.44% 0.44% NA
Indica Intermediate  786 89.20% 9.20% 1.15% 0.51% NA
Temperate Japonica  767 6.80% 92.30% 0.65% 0.26% NA
Tropical Japonica  504 63.90% 8.90% 2.18% 25.00% NA
Japonica Intermediate  241 62.70% 29.90% 1.24% 6.22% NA
VI/Aromatic  96 92.70% 0.00% 1.04% 6.25% NA
Intermediate  90 72.20% 20.00% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812148045 T -> C LOC_Os08g20230.1 upstream_gene_variant ; 4558.0bp to feature; MODIFIER silent_mutation Average:74.15; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0812148045 T -> C LOC_Os08g20250.1 downstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:74.15; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0812148045 T -> C LOC_Os08g20230-LOC_Os08g20250 intergenic_region ; MODIFIER silent_mutation Average:74.15; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N
vg0812148045 T -> DEL N N silent_mutation Average:74.15; most accessible tissue: Zhenshan97 young leaf, score: 83.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812148045 NA 1.58E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 8.69E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 2.40E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 3.80E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 8.82E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 1.71E-07 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 6.78E-06 4.77E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 1.10E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 3.06E-07 3.06E-07 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 2.08E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 1.81E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 8.94E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 2.44E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812148045 NA 1.26E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251