\
| Variant ID: vg0812109370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12109370 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 218. )
CATTATAAGCATATTGAATAGGAGCAAAACTAGAAGTAGTATATGCATCTACACAATGATTATTAGCAAAGGACGGATTGGACGAATCGGAGGTTACCTT[T/C]
GGTGAAACTACAACTTGGGGAAGCGAGACATTTCCCTTCACGACGCCTTGATTGTTCCTGATGTATGATTTCATCAACAGCTCCTGCGTAACCACCATCA
TGATGGTGGTTACGCAGGAGCTGTTGATGAAATCATACATCAGGAACAATCAAGGCGTCGTGAAGGGAAATGTCTCGCTTCCCCAAGTTGTAGTTTCACC[A/G]
AAGGTAACCTCCGATTCGTCCAATCCGTCCTTTGCTAATAATCATTGTGTAGATGCATATACTACTTCTAGTTTTGCTCCTATTCAATATGCTTATAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.20% | 40.80% | 0.72% | 8.21% | NA |
| All Indica | 2759 | 83.40% | 7.30% | 0.98% | 8.34% | NA |
| All Japonica | 1512 | 2.20% | 88.00% | 0.13% | 9.72% | NA |
| Aus | 269 | 2.60% | 97.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.80% | 0.30% | 0.84% | 2.02% | NA |
| Indica II | 465 | 86.70% | 7.70% | 1.08% | 4.52% | NA |
| Indica III | 913 | 78.00% | 6.90% | 0.22% | 14.90% | NA |
| Indica Intermediate | 786 | 77.50% | 12.80% | 1.91% | 7.76% | NA |
| Temperate Japonica | 767 | 2.00% | 97.70% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 1.60% | 72.40% | 0.20% | 25.79% | NA |
| Japonica Intermediate | 241 | 4.10% | 89.60% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 2.10% | 88.50% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 35.60% | 57.80% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812109370 | T -> C | LOC_Os08g20180.1 | synonymous_variant ; p.Pro55Pro; LOW | synonymous_codon | Average:64.173; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0812109370 | T -> DEL | LOC_Os08g20180.1 | N | frameshift_variant | Average:64.173; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812109370 | NA | 3.00E-08 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 8.66E-08 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 1.27E-20 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 3.88E-07 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 2.31E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 3.60E-18 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 4.66E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 1.26E-06 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 8.80E-13 | mr1134_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 1.59E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 1.26E-10 | mr1504_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 7.41E-08 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812109370 | NA | 1.40E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |