\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812106092:

Variant ID: vg0812106092 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12106092
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTCTAACATGGCATAGGCATATAACGGTAAACACAATAAACTCATACCTTGCCTTAGCATCCAACAAACGGCGGCTCAAAAATGTGATGTCGTATC[C/A]
ATCGCCGTTCATCTCTCTTGATTTCTTCATAAGCATATTGATGTCTTGCCCCCCGAACAAAATTGGCTTTCTTGGTTGCGCGATTTCGAAGGCAAGATAA

Reverse complement sequence

TTATCTTGCCTTCGAAATCGCGCAACCAAGAAAGCCAATTTTGTTCGGGGGGCAAGACATCAATATGCTTATGAAGAAATCAAGAGAGATGAACGGCGAT[G/T]
GATACGACATCACATTTTTGAGCCGCCGTTTGTTGGATGCTAAGGCAAGGTATGAGTTTATTGTGTTTACCGTTATATGCCTATGCCATGTTAGAAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 39.70% 0.13% 8.29% NA
All Indica  2759 84.80% 6.60% 0.07% 8.52% NA
All Japonica  1512 2.30% 87.90% 0.13% 9.66% NA
Aus  269 16.70% 82.90% 0.00% 0.37% NA
Indica I  595 97.80% 0.20% 0.00% 2.02% NA
Indica II  465 87.70% 7.30% 0.22% 4.73% NA
Indica III  913 78.40% 6.50% 0.11% 15.01% NA
Indica Intermediate  786 80.50% 11.30% 0.00% 8.14% NA
Temperate Japonica  767 2.10% 97.70% 0.00% 0.26% NA
Tropical Japonica  504 1.40% 72.60% 0.40% 25.60% NA
Japonica Intermediate  241 5.00% 88.80% 0.00% 6.22% NA
VI/Aromatic  96 2.10% 90.60% 1.04% 6.25% NA
Intermediate  90 36.70% 57.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812106092 C -> A LOC_Os08g20180.1 N stop_gained Average:31.254; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg0812106092 C -> DEL LOC_Os08g20180.1 N frameshift_variant Average:31.254; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812106092 NA 7.30E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 8.69E-07 6.12E-08 mr1218 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.48E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 2.31E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 2.48E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 4.57E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 3.12E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 3.10E-16 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.64E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 2.74E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 6.93E-06 mr1835 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.48E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 5.37E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.87E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.18E-08 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 1.04E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812106092 NA 4.02E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251