\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812088790:

Variant ID: vg0812088790 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12088790
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCAGCTCCTGCAGCTCCAGCTCCAGTCCCGGCTCCAGTCCCAGTGTCAGCTCCCTGCGTCCGCTCTCTCCTTCGCTCCAGCATCAGCCGCCAGGGGTC[C/T]
AGCCAGTGGCAATGGAGGTTGGTTGCCTGCTACTCCCAGTGGCAGCCGCGACCACAGCAGCAGCAGTTCAGTGGCTCAGAGTCGGGCAGTGGCGAGACGT

Reverse complement sequence

ACGTCTCGCCACTGCCCGACTCTGAGCCACTGAACTGCTGCTGCTGTGGTCGCGGCTGCCACTGGGAGTAGCAGGCAACCAACCTCCATTGCCACTGGCT[G/A]
GACCCCTGGCGGCTGATGCTGGAGCGAAGGAGAGAGCGGACGCAGGGAGCTGACACTGGGACTGGAGCCGGGACTGGAGCTGGAGCTGCAGGAGCTGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 11.40% 1.95% 2.56% NA
All Indica  2759 97.50% 0.10% 2.25% 0.07% NA
All Japonica  1512 62.30% 28.50% 1.59% 7.61% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.84% 0.00% NA
Indica II  465 97.20% 0.20% 2.37% 0.22% NA
Indica III  913 97.00% 0.10% 2.85% 0.00% NA
Indica Intermediate  786 97.10% 0.30% 2.54% 0.13% NA
Temperate Japonica  767 97.40% 2.30% 0.00% 0.26% NA
Tropical Japonica  504 17.50% 58.50% 4.56% 19.44% NA
Japonica Intermediate  241 44.40% 49.00% 0.41% 6.22% NA
VI/Aromatic  96 6.20% 87.50% 3.12% 3.12% NA
Intermediate  90 74.40% 21.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812088790 C -> T LOC_Os08g20170.1 synonymous_variant ; p.Ser257Ser; LOW synonymous_codon Average:63.664; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0812088790 C -> DEL LOC_Os08g20170.1 N frameshift_variant Average:63.664; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0812088790 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812088790 NA 9.63E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812088790 NA 2.12E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812088790 NA 8.45E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812088790 NA 7.88E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812088790 4.23E-07 NA mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812088790 8.96E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251