\
| Variant ID: vg0812069180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12069180 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )
ATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCGGATATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGGAGAGCAATTGAGTTGAGA[G/A,T]
TTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGAAAACACAGAGAGAATCAATAAAGTCGTCATCCACTCTAA
TTAGAGTGGATGACGACTTTATTGATTCTCTCTGTGTTTTCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAA[C/T,A]
TCTCAACTCAATTGCTCTCCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATATCCGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 8.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.60% | 8.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 9.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.60% | 26.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812069180 | G -> T | LOC_Os08g20140.1 | upstream_gene_variant ; 1583.0bp to feature; MODIFIER | N | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> T | LOC_Os08g20150.1 | upstream_gene_variant ; 3744.0bp to feature; MODIFIER | N | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> T | LOC_Os08g20130.1 | downstream_gene_variant ; 723.0bp to feature; MODIFIER | N | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> T | LOC_Os08g20130-LOC_Os08g20140 | intergenic_region ; MODIFIER | N | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> A | LOC_Os08g20140.1 | upstream_gene_variant ; 1583.0bp to feature; MODIFIER | silent_mutation | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> A | LOC_Os08g20150.1 | upstream_gene_variant ; 3744.0bp to feature; MODIFIER | silent_mutation | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> A | LOC_Os08g20130.1 | downstream_gene_variant ; 723.0bp to feature; MODIFIER | silent_mutation | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0812069180 | G -> A | LOC_Os08g20130-LOC_Os08g20140 | intergenic_region ; MODIFIER | silent_mutation | Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812069180 | 2.95E-06 | NA | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 1.36E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 3.80E-06 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | 3.78E-06 | NA | mr1503 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | 2.94E-06 | NA | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 2.76E-07 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 9.74E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 2.85E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 1.88E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 7.08E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 3.43E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812069180 | NA | 1.49E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |