\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812069180:

Variant ID: vg0812069180 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12069180
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCGGATATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGGAGAGCAATTGAGTTGAGA[G/A,T]
TTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGAAAACACAGAGAGAATCAATAAAGTCGTCATCCACTCTAA

Reverse complement sequence

TTAGAGTGGATGACGACTTTATTGATTCTCTCTGTGTTTTCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAA[C/T,A]
TCTCAACTCAATTGCTCTCCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATATCCGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.30% 0.04% 0.00% NA
All Indica  2759 91.60% 8.30% 0.04% 0.00% NA
All Japonica  1512 90.10% 9.90% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 85.20% 14.80% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 73.60% 26.20% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812069180 G -> T LOC_Os08g20140.1 upstream_gene_variant ; 1583.0bp to feature; MODIFIER N Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> T LOC_Os08g20150.1 upstream_gene_variant ; 3744.0bp to feature; MODIFIER N Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> T LOC_Os08g20130.1 downstream_gene_variant ; 723.0bp to feature; MODIFIER N Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> T LOC_Os08g20130-LOC_Os08g20140 intergenic_region ; MODIFIER N Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> A LOC_Os08g20140.1 upstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> A LOC_Os08g20150.1 upstream_gene_variant ; 3744.0bp to feature; MODIFIER silent_mutation Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> A LOC_Os08g20130.1 downstream_gene_variant ; 723.0bp to feature; MODIFIER silent_mutation Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0812069180 G -> A LOC_Os08g20130-LOC_Os08g20140 intergenic_region ; MODIFIER silent_mutation Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812069180 2.95E-06 NA mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 1.36E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 3.80E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 3.78E-06 NA mr1503 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 2.94E-06 NA mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 2.76E-07 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 9.74E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 2.85E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 1.88E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 7.08E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 3.43E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180 NA 1.49E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251