Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812069180:

Variant ID: vg0812069180 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12069180
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCGGATATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGGAGAGCAATTGAGTTGAGA[G/A,T]
TTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGAAAACACAGAGAGAATCAATAAAGTCGTCATCCACTCTAA

Reverse complement sequence

TTAGAGTGGATGACGACTTTATTGATTCTCTCTGTGTTTTCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAA[C/T,A]
TCTCAACTCAATTGCTCTCCAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATATCCGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	8.30%	0.04%	0.00%	NA
All Indica	2759	91.60%	8.30%	0.04%	0.00%	NA
All Japonica	1512	90.10%	9.90%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	85.20%	14.80%	0.00%	0.00%	NA
Indica Intermediate	786	92.10%	7.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	73.60%	26.20%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812069180	G -> T	LOC_Os08g20140.1	upstream_gene_variant ; 1583.0bp to feature; MODIFIER	N	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> T	LOC_Os08g20150.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	N	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> T	LOC_Os08g20130.1	downstream_gene_variant ; 723.0bp to feature; MODIFIER	N	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> T	LOC_Os08g20130-LOC_Os08g20140	intergenic_region ; MODIFIER	N	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> A	LOC_Os08g20140.1	upstream_gene_variant ; 1583.0bp to feature; MODIFIER	silent_mutation	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> A	LOC_Os08g20150.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> A	LOC_Os08g20130.1	downstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0812069180	G -> A	LOC_Os08g20130-LOC_Os08g20140	intergenic_region ; MODIFIER	silent_mutation	Average:38.882; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812069180	2.95E-06	NA	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	1.36E-06	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	3.80E-06	mr1135	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	3.78E-06	NA	mr1503	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	2.94E-06	NA	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	2.76E-07	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	9.74E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	2.85E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	1.88E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	7.08E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	3.43E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812069180	NA	1.49E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251