Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812050496:

Variant ID: vg0812050496 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12050496
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCCGAGACTACGAGCGCCACCGGTGCTGCAGCACCCGTCGCACCGCCACCTGCTGCATCCGTTGAGCCGTGGCCACCGCCGCTACATGCCTTTGCTGC[C/T]
AGCCGATCCTCATCTCTTCAGGAATAGGAAGTCAGCAGCTCATCACAAGTCAGGCCGAGTTTAGTTCCAAACTTTTTCTTTAAACTTCCAATTTTTCTAT

Reverse complement sequence

ATAGAAAAATTGGAAGTTTAAAGAAAAAGTTTGGAACTAAACTCGGCCTGACTTGTGATGAGCTGCTGACTTCCTATTCCTGAAGAGATGAGGATCGGCT[G/A]
GCAGCAAAGGCATGTAGCGGCGGTGGCCACGGCTCAACGGATGCAGCAGGTGGCGGTGCGACGGGTGCTGCAGCACCGGTGGCGCTCGTAGTCTCGGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	8.40%	2.12%	0.21%	NA
All Indica	2759	99.70%	0.10%	0.00%	0.22%	NA
All Japonica	1512	73.10%	21.10%	5.56%	0.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.10%	0.00%	0.44%	NA
Indica Intermediate	786	99.60%	0.10%	0.00%	0.25%	NA
Temperate Japonica	767	98.20%	1.70%	0.13%	0.00%	NA
Tropical Japonica	504	45.80%	38.90%	14.88%	0.40%	NA
Japonica Intermediate	241	50.20%	45.60%	3.32%	0.83%	NA
VI/Aromatic	96	26.00%	59.40%	14.58%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812050496	C -> T	LOC_Os08g20100.1	upstream_gene_variant ; 1273.0bp to feature; MODIFIER	silent_mutation	Average:18.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0812050496	C -> T	LOC_Os08g20110.1	upstream_gene_variant ; 2434.0bp to feature; MODIFIER	silent_mutation	Average:18.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0812050496	C -> T	LOC_Os08g20090.2	downstream_gene_variant ; 4663.0bp to feature; MODIFIER	silent_mutation	Average:18.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0812050496	C -> T	LOC_Os08g20100-LOC_Os08g20110	intergenic_region ; MODIFIER	silent_mutation	Average:18.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N
vg0812050496	C -> DEL	N	N	silent_mutation	Average:18.6; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812050496	NA	4.60E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812050496	NA	4.39E-06	mr1123_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812050496	4.55E-06	4.14E-07	mr1242_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812050496	NA	9.18E-08	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812050496	NA	7.94E-06	mr1936_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251