\
| Variant ID: vg0812038921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12038921 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGAACCCATCCTAGCACCGTTGGATGCAGGGTTCGGCGTGGACGTCCAGGATTGCATCCCAATGACGGTCGGAGGGCACTTCGGACAATTCCCCTTCCA[C/T]
AACTGTCATAACTACCTCTATATAAGGACTTCACCTTCTCACTTCACTCACACACCTCAAGCAAGAGCTCTCTCATATTCTCTCAAGTTTAGTTTAGTAT
ATACTAAACTAAACTTGAGAGAATATGAGAGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAAGTCCTTATATAGAGGTAGTTATGACAGTT[G/A]
TGGAAGGGGAATTGTCCGAAGTGCCCTCCGACCGTCATTGGGATGCAATCCTGGACGTCCACGCCGAACCCTGCATCCAACGGTGCTAGGATGGGTTCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.00% | 8.40% | 7.15% | 52.48% | NA |
| All Indica | 2759 | 14.00% | 0.40% | 5.76% | 79.81% | NA |
| All Japonica | 1512 | 62.80% | 25.10% | 8.60% | 3.44% | NA |
| Aus | 269 | 14.50% | 0.00% | 15.99% | 69.52% | NA |
| Indica I | 595 | 4.00% | 0.00% | 8.24% | 87.73% | NA |
| Indica II | 465 | 12.00% | 0.20% | 3.87% | 83.87% | NA |
| Indica III | 913 | 21.80% | 0.90% | 4.82% | 72.51% | NA |
| Indica Intermediate | 786 | 13.60% | 0.40% | 6.11% | 79.90% | NA |
| Temperate Japonica | 767 | 45.40% | 38.20% | 13.43% | 3.00% | NA |
| Tropical Japonica | 504 | 86.70% | 7.90% | 1.98% | 3.37% | NA |
| Japonica Intermediate | 241 | 68.50% | 19.50% | 7.05% | 4.98% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 52.20% | 4.40% | 6.67% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812038921 | C -> T | LOC_Os08g20070.1 | upstream_gene_variant ; 3744.0bp to feature; MODIFIER | silent_mutation | Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0812038921 | C -> T | LOC_Os08g20090.2 | upstream_gene_variant ; 4421.0bp to feature; MODIFIER | silent_mutation | Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0812038921 | C -> T | LOC_Os08g20080.1 | downstream_gene_variant ; 1023.0bp to feature; MODIFIER | silent_mutation | Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0812038921 | C -> T | LOC_Os08g20080-LOC_Os08g20090 | intergenic_region ; MODIFIER | silent_mutation | Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0812038921 | C -> DEL | N | N | silent_mutation | Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812038921 | NA | 8.53E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | 6.29E-06 | 3.91E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | NA | 1.97E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | NA | 1.30E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | NA | 4.89E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | 4.18E-06 | 1.01E-13 | mr1182_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038921 | NA | 2.83E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |