\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812038921:

Variant ID: vg0812038921 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12038921
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAACCCATCCTAGCACCGTTGGATGCAGGGTTCGGCGTGGACGTCCAGGATTGCATCCCAATGACGGTCGGAGGGCACTTCGGACAATTCCCCTTCCA[C/T]
AACTGTCATAACTACCTCTATATAAGGACTTCACCTTCTCACTTCACTCACACACCTCAAGCAAGAGCTCTCTCATATTCTCTCAAGTTTAGTTTAGTAT

Reverse complement sequence

ATACTAAACTAAACTTGAGAGAATATGAGAGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAAGTCCTTATATAGAGGTAGTTATGACAGTT[G/A]
TGGAAGGGGAATTGTCCGAAGTGCCCTCCGACCGTCATTGGGATGCAATCCTGGACGTCCACGCCGAACCCTGCATCCAACGGTGCTAGGATGGGTTCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 8.40% 7.15% 52.48% NA
All Indica  2759 14.00% 0.40% 5.76% 79.81% NA
All Japonica  1512 62.80% 25.10% 8.60% 3.44% NA
Aus  269 14.50% 0.00% 15.99% 69.52% NA
Indica I  595 4.00% 0.00% 8.24% 87.73% NA
Indica II  465 12.00% 0.20% 3.87% 83.87% NA
Indica III  913 21.80% 0.90% 4.82% 72.51% NA
Indica Intermediate  786 13.60% 0.40% 6.11% 79.90% NA
Temperate Japonica  767 45.40% 38.20% 13.43% 3.00% NA
Tropical Japonica  504 86.70% 7.90% 1.98% 3.37% NA
Japonica Intermediate  241 68.50% 19.50% 7.05% 4.98% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 52.20% 4.40% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812038921 C -> T LOC_Os08g20070.1 upstream_gene_variant ; 3744.0bp to feature; MODIFIER silent_mutation Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0812038921 C -> T LOC_Os08g20090.2 upstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0812038921 C -> T LOC_Os08g20080.1 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0812038921 C -> T LOC_Os08g20080-LOC_Os08g20090 intergenic_region ; MODIFIER silent_mutation Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0812038921 C -> DEL N N silent_mutation Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812038921 NA 8.53E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 6.29E-06 3.91E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 NA 1.97E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 NA 1.30E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 NA 4.89E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 4.18E-06 1.01E-13 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921 NA 2.83E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251