Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812038921:

Variant ID: vg0812038921 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12038921
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGAACCCATCCTAGCACCGTTGGATGCAGGGTTCGGCGTGGACGTCCAGGATTGCATCCCAATGACGGTCGGAGGGCACTTCGGACAATTCCCCTTCCA[C/T]
AACTGTCATAACTACCTCTATATAAGGACTTCACCTTCTCACTTCACTCACACACCTCAAGCAAGAGCTCTCTCATATTCTCTCAAGTTTAGTTTAGTAT

Reverse complement sequence

ATACTAAACTAAACTTGAGAGAATATGAGAGAGCTCTTGCTTGAGGTGTGTGAGTGAAGTGAGAAGGTGAAGTCCTTATATAGAGGTAGTTATGACAGTT[G/A]
TGGAAGGGGAATTGTCCGAAGTGCCCTCCGACCGTCATTGGGATGCAATCCTGGACGTCCACGCCGAACCCTGCATCCAACGGTGCTAGGATGGGTTCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.00%	8.40%	7.15%	52.48%	NA
All Indica	2759	14.00%	0.40%	5.76%	79.81%	NA
All Japonica	1512	62.80%	25.10%	8.60%	3.44%	NA
Aus	269	14.50%	0.00%	15.99%	69.52%	NA
Indica I	595	4.00%	0.00%	8.24%	87.73%	NA
Indica II	465	12.00%	0.20%	3.87%	83.87%	NA
Indica III	913	21.80%	0.90%	4.82%	72.51%	NA
Indica Intermediate	786	13.60%	0.40%	6.11%	79.90%	NA
Temperate Japonica	767	45.40%	38.20%	13.43%	3.00%	NA
Tropical Japonica	504	86.70%	7.90%	1.98%	3.37%	NA
Japonica Intermediate	241	68.50%	19.50%	7.05%	4.98%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	52.20%	4.40%	6.67%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812038921	C -> T	LOC_Os08g20070.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0812038921	C -> T	LOC_Os08g20090.2	upstream_gene_variant ; 4421.0bp to feature; MODIFIER	silent_mutation	Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0812038921	C -> T	LOC_Os08g20080.1	downstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0812038921	C -> T	LOC_Os08g20080-LOC_Os08g20090	intergenic_region ; MODIFIER	silent_mutation	Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0812038921	C -> DEL	N	N	silent_mutation	Average:15.337; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812038921	NA	8.53E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	6.29E-06	3.91E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	NA	1.97E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	NA	1.30E-06	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	NA	4.89E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	4.18E-06	1.01E-13	mr1182_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038921	NA	2.83E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251