\
| Variant ID: vg0812038083 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12038083 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )
ACACCAAGCATCTGGCTAAAATGTGAAGAAAGGAGTATTTTTTATATTAGAAAAGCCGGTGTTTGATTTTAAATCTTTGGGATAAATTGGCGAAGTTCCA[T/G]
ATTGGGGGCGGTCTGACCGACGCATTATAACCGGTCTAACTGCGGATGACCGGCGGTTTGACCGGCATTACCGATCCCAGACATGAAGCTGGGGGGCATG
CATGCCCCCCAGCTTCATGTCTGGGATCGGTAATGCCGGTCAAACCGCCGGTCATCCGCAGTTAGACCGGTTATAATGCGTCGGTCAGACCGCCCCCAAT[A/C]
TGGAACTTCGCCAATTTATCCCAAAGATTTAAAATCAAACACCGGCTTTTCTAATATAAAAAATACTCCTTTCTTCACATTTTAGCCAGATGCTTGGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.80% | 6.30% | 3.77% | 60.07% | NA |
| All Indica | 2759 | 10.40% | 2.20% | 1.74% | 85.68% | NA |
| All Japonica | 1512 | 65.60% | 14.80% | 8.07% | 11.51% | NA |
| Aus | 269 | 0.70% | 2.60% | 0.74% | 95.91% | NA |
| Indica I | 595 | 2.70% | 1.80% | 3.53% | 91.93% | NA |
| Indica II | 465 | 5.20% | 5.60% | 3.23% | 86.02% | NA |
| Indica III | 913 | 18.10% | 0.30% | 0.00% | 81.60% | NA |
| Indica Intermediate | 786 | 10.40% | 2.50% | 1.53% | 85.50% | NA |
| Temperate Japonica | 767 | 53.80% | 26.70% | 14.73% | 4.69% | NA |
| Tropical Japonica | 504 | 79.00% | 0.80% | 0.20% | 20.04% | NA |
| Japonica Intermediate | 241 | 75.10% | 6.20% | 3.32% | 15.35% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 43.30% | 8.90% | 6.67% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812038083 | T -> G | LOC_Os08g20070.1 | upstream_gene_variant ; 2906.0bp to feature; MODIFIER | silent_mutation | Average:12.561; most accessible tissue: Callus, score: 37.131 | N | N | N | N |
| vg0812038083 | T -> G | LOC_Os08g20080.1 | downstream_gene_variant ; 185.0bp to feature; MODIFIER | silent_mutation | Average:12.561; most accessible tissue: Callus, score: 37.131 | N | N | N | N |
| vg0812038083 | T -> G | LOC_Os08g20080-LOC_Os08g20090 | intergenic_region ; MODIFIER | silent_mutation | Average:12.561; most accessible tissue: Callus, score: 37.131 | N | N | N | N |
| vg0812038083 | T -> DEL | N | N | silent_mutation | Average:12.561; most accessible tissue: Callus, score: 37.131 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812038083 | NA | 5.47E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | NA | 9.00E-06 | mr1269_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | NA | 5.11E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | NA | 7.83E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | 3.63E-09 | NA | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | NA | 3.14E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | 9.66E-07 | 9.62E-07 | mr1919_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812038083 | NA | 2.23E-06 | mr1919_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |