Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812038025:

Variant ID: vg0812038025 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12038025
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, G: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGTGTTATAATTTTTCATATATCCAGAAAGAAGGAATTTTTGTCCAGTTATTTGATACACCAAGCATCTGGCTAAAATGTGAAGAAAGGAGTATTTTT[T/G,A]
ATATTAGAAAAGCCGGTGTTTGATTTTAAATCTTTGGGATAAATTGGCGAAGTTCCATATTGGGGGCGGTCTGACCGACGCATTATAACCGGTCTAACTG

Reverse complement sequence

CAGTTAGACCGGTTATAATGCGTCGGTCAGACCGCCCCCAATATGGAACTTCGCCAATTTATCCCAAAGATTTAAAATCAAACACCGGCTTTTCTAATAT[A/C,T]
AAAAATACTCCTTTCTTCACATTTTAGCCAGATGCTTGGTGTATCAAATAACTGGACAAAAATTCCTTCTTTCTGGATATATGAAAAATTATAACACCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.60%	19.30%	0.38%	60.62%	A: 0.11%
All Indica	2759	10.70%	2.20%	0.47%	86.52%	A: 0.14%
All Japonica	1512	33.50%	54.90%	0.07%	11.51%	NA
Aus	269	0.70%	0.70%	1.12%	97.03%	A: 0.37%
Indica I	595	2.70%	3.70%	0.50%	93.11%	NA
Indica II	465	8.40%	2.60%	0.22%	88.82%	NA
Indica III	913	17.40%	1.10%	0.33%	80.83%	A: 0.33%
Indica Intermediate	786	10.20%	2.20%	0.76%	86.77%	A: 0.13%
Temperate Japonica	767	2.60%	92.60%	0.13%	4.69%	NA
Tropical Japonica	504	70.80%	8.90%	0.00%	20.24%	NA
Japonica Intermediate	241	53.90%	31.10%	0.00%	14.94%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	37.80%	20.00%	1.11%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812038025	T -> G	LOC_Os08g20070.1	upstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> G	LOC_Os08g20080.1	downstream_gene_variant ; 127.0bp to feature; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> G	LOC_Os08g20080-LOC_Os08g20090	intergenic_region ; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> A	LOC_Os08g20070.1	upstream_gene_variant ; 2848.0bp to feature; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> A	LOC_Os08g20080.1	downstream_gene_variant ; 127.0bp to feature; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> A	LOC_Os08g20080-LOC_Os08g20090	intergenic_region ; MODIFIER	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N
vg0812038025	T -> DEL	N	N	silent_mutation	Average:9.7; most accessible tissue: Callus, score: 46.189	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812038025	NA	4.64E-06	mr1084	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	4.07E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	4.54E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	9.93E-06	3.63E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	1.45E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	1.66E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	9.11E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	4.83E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	2.58E-06	2.58E-06	mr1464	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	5.31E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	2.35E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	2.08E-06	NA	mr1743	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	1.31E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	6.20E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	2.74E-08	2.74E-08	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	1.39E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	6.07E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025	NA	5.38E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251