\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812038025:

Variant ID: vg0812038025 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12038025
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, G: 0.20, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTGTTATAATTTTTCATATATCCAGAAAGAAGGAATTTTTGTCCAGTTATTTGATACACCAAGCATCTGGCTAAAATGTGAAGAAAGGAGTATTTTT[T/G,A]
ATATTAGAAAAGCCGGTGTTTGATTTTAAATCTTTGGGATAAATTGGCGAAGTTCCATATTGGGGGCGGTCTGACCGACGCATTATAACCGGTCTAACTG

Reverse complement sequence

CAGTTAGACCGGTTATAATGCGTCGGTCAGACCGCCCCCAATATGGAACTTCGCCAATTTATCCCAAAGATTTAAAATCAAACACCGGCTTTTCTAATAT[A/C,T]
AAAAATACTCCTTTCTTCACATTTTAGCCAGATGCTTGGTGTATCAAATAACTGGACAAAAATTCCTTCTTTCTGGATATATGAAAAATTATAACACCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.60% 19.30% 0.38% 60.62% A: 0.11%
All Indica  2759 10.70% 2.20% 0.47% 86.52% A: 0.14%
All Japonica  1512 33.50% 54.90% 0.07% 11.51% NA
Aus  269 0.70% 0.70% 1.12% 97.03% A: 0.37%
Indica I  595 2.70% 3.70% 0.50% 93.11% NA
Indica II  465 8.40% 2.60% 0.22% 88.82% NA
Indica III  913 17.40% 1.10% 0.33% 80.83% A: 0.33%
Indica Intermediate  786 10.20% 2.20% 0.76% 86.77% A: 0.13%
Temperate Japonica  767 2.60% 92.60% 0.13% 4.69% NA
Tropical Japonica  504 70.80% 8.90% 0.00% 20.24% NA
Japonica Intermediate  241 53.90% 31.10% 0.00% 14.94% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 37.80% 20.00% 1.11% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812038025 T -> G LOC_Os08g20070.1 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> G LOC_Os08g20080.1 downstream_gene_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> G LOC_Os08g20080-LOC_Os08g20090 intergenic_region ; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> A LOC_Os08g20070.1 upstream_gene_variant ; 2848.0bp to feature; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> A LOC_Os08g20080.1 downstream_gene_variant ; 127.0bp to feature; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> A LOC_Os08g20080-LOC_Os08g20090 intergenic_region ; MODIFIER silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N
vg0812038025 T -> DEL N N silent_mutation Average:9.7; most accessible tissue: Callus, score: 46.189 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812038025 NA 4.64E-06 mr1084 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 4.07E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 4.54E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 9.93E-06 3.63E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 1.45E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 1.66E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 9.11E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 4.83E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 2.58E-06 2.58E-06 mr1464 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 5.31E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 2.35E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 2.08E-06 NA mr1743 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 1.31E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 6.20E-07 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 2.74E-08 2.74E-08 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 1.39E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 6.07E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812038025 NA 5.38E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251