\
| Variant ID: vg0812023942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12023942 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTAACCGTGCCAACCACAAGCCAGAATGGGCAACGGCTGGACACTTTGTATAACAAGGCTCACTGCGGAGCACCAGACTGAGAAGTGGCGGAGATAAGC[C/T]
CACGGGGGTCACTGGGGAGTCCATGCCTTGTTTATAAGGGGGTCACTATGATCCGGGAACGGTGCACTGCTTTGGGTTGAGTTATGCGAGGGGTCTTGTC
GACAAGACCCCTCGCATAACTCAACCCAAAGCAGTGCACCGTTCCCGGATCATAGTGACCCCCTTATAAACAAGGCATGGACTCCCCAGTGACCCCCGTG[G/A]
GCTTATCTCCGCCACTTCTCAGTCTGGTGCTCCGCAGTGAGCCTTGTTATACAAAGTGTCCAGCCGTTGCCCATTCTGGCTTGTGGTTGGCACGGTTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 0.10% | 25.67% | 29.26% | NA |
| All Indica | 2759 | 20.90% | 0.20% | 38.06% | 40.85% | NA |
| All Japonica | 1512 | 84.90% | 0.00% | 1.98% | 13.16% | NA |
| Aus | 269 | 45.00% | 0.00% | 43.49% | 11.52% | NA |
| Indica I | 595 | 36.60% | 0.20% | 22.18% | 41.01% | NA |
| Indica II | 465 | 18.70% | 0.40% | 31.18% | 49.68% | NA |
| Indica III | 913 | 8.20% | 0.30% | 54.22% | 37.24% | NA |
| Indica Intermediate | 786 | 24.90% | 0.00% | 35.37% | 39.69% | NA |
| Temperate Japonica | 767 | 95.70% | 0.00% | 1.17% | 3.13% | NA |
| Tropical Japonica | 504 | 69.20% | 0.00% | 2.38% | 28.37% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.00% | 3.73% | 13.28% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 3.12% | 8.33% | NA |
| Intermediate | 90 | 65.60% | 0.00% | 14.44% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812023942 | C -> T | LOC_Os08g20060.1 | downstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:14.171; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0812023942 | C -> T | LOC_Os08g20050-LOC_Os08g20060 | intergenic_region ; MODIFIER | silent_mutation | Average:14.171; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| vg0812023942 | C -> DEL | N | N | silent_mutation | Average:14.171; most accessible tissue: Minghui63 root, score: 21.615 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812023942 | 6.50E-09 | NA | mr1089 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.48E-09 | 1.22E-13 | mr1089 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.43E-10 | NA | mr1093 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 2.66E-10 | 4.64E-15 | mr1093 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 9.19E-14 | 9.89E-51 | mr1109 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.04E-11 | 8.52E-21 | mr1109 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 6.12E-12 | 1.24E-39 | mr1129 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 4.35E-11 | 3.84E-20 | mr1129 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.21E-08 | NA | mr1235 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 3.57E-09 | 9.65E-13 | mr1235 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 5.91E-07 | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 4.18E-08 | 7.49E-30 | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 6.43E-06 | 4.39E-13 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.74E-08 | 1.19E-20 | mr1253 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 6.42E-08 | 2.03E-12 | mr1253 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.07E-11 | 7.62E-34 | mr1255 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.07E-08 | 4.35E-16 | mr1255 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 9.25E-15 | 9.24E-44 | mr1257 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 4.00E-13 | 4.50E-22 | mr1257 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 1.11E-07 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.45E-08 | NA | mr1423 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.92E-08 | 3.55E-13 | mr1423 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 9.44E-12 | 1.52E-37 | mr1435 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.35E-09 | 4.30E-18 | mr1435 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 7.86E-09 | NA | mr1599 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 4.60E-09 | 7.37E-14 | mr1599 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 4.64E-11 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 1.48E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.48E-08 | NA | mr1109_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 2.35E-06 | 8.30E-19 | mr1109_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.23E-07 | 1.45E-37 | mr1129_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 4.15E-18 | mr1129_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 8.65E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 2.01E-06 | NA | mr1212_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 3.00E-08 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 5.11E-10 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 5.00E-10 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 7.67E-06 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 9.21E-06 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 8.92E-14 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 9.62E-07 | 6.49E-22 | mr1253_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 4.53E-06 | 2.67E-11 | mr1253_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 9.58E-25 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 1.75E-11 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | 1.62E-06 | 1.48E-37 | mr1257_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 5.13E-18 | mr1257_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 8.37E-06 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 1.64E-07 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 1.06E-13 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 8.43E-07 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 2.78E-13 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812023942 | NA | 8.87E-10 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |