\
| Variant ID: vg0812016141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12016141 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 113. )
AGCCATGCCCCTTCCATGATCATGCCAAGAGAACAAAATGGAGAGAAAGTATAGGAAAAAAGGAGAATAAATTTTTCCATCATTCCACAATATATTTTAC[G/T]
TTTTCATTTTCCACCACAAATAAAAACCCTTGATCTAAGAGCATGATTGATGATCTTCTTGAGTCCACATTTTTGGTTTTGCAATATATATGATGCAGGT
ACCTGCATCATATATATTGCAAAACCAAAAATGTGGACTCAAGAAGATCATCAATCATGCTCTTAGATCAAGGGTTTTTATTTGTGGTGGAAAATGAAAA[C/A]
GTAAAATATATTGTGGAATGATGGAAAAATTTATTCTCCTTTTTTCCTATACTTTCTCTCCATTTTGTTCTCTTGGCATGATCATGGAAGGGGCATGGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.20% | 19.60% | 1.12% | 55.16% | NA |
| All Indica | 2759 | 12.00% | 10.80% | 0.54% | 76.66% | NA |
| All Japonica | 1512 | 51.50% | 33.50% | 2.38% | 12.57% | NA |
| Aus | 269 | 1.90% | 1.10% | 0.00% | 97.03% | NA |
| Indica I | 595 | 30.60% | 2.50% | 1.01% | 65.88% | NA |
| Indica II | 465 | 9.50% | 8.80% | 0.65% | 81.08% | NA |
| Indica III | 913 | 1.00% | 17.60% | 0.11% | 81.27% | NA |
| Indica Intermediate | 786 | 12.30% | 10.20% | 0.64% | 76.84% | NA |
| Temperate Japonica | 767 | 85.50% | 10.20% | 0.00% | 4.30% | NA |
| Tropical Japonica | 504 | 9.90% | 59.70% | 7.14% | 23.21% | NA |
| Japonica Intermediate | 241 | 30.30% | 53.10% | 0.00% | 16.60% | NA |
| VI/Aromatic | 96 | 0.00% | 90.60% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 28.90% | 33.30% | 2.22% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812016141 | G -> T | LOC_Os08g20050.1 | downstream_gene_variant ; 1059.0bp to feature; MODIFIER | silent_mutation | Average:12.811; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| vg0812016141 | G -> T | LOC_Os08g20050-LOC_Os08g20060 | intergenic_region ; MODIFIER | silent_mutation | Average:12.811; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| vg0812016141 | G -> DEL | N | N | silent_mutation | Average:12.811; most accessible tissue: Callus, score: 25.742 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812016141 | NA | 6.06E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 1.39E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 1.75E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 2.14E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 3.13E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 1.08E-07 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | 9.56E-08 | 9.55E-08 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 2.61E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 9.99E-06 | mr1362_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 7.41E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 4.26E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 1.17E-08 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 1.19E-08 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | NA | 6.78E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812016141 | 2.47E-06 | 4.27E-07 | mr1836_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |