\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812014490:

Variant ID: vg0812014490 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12014490
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGAGCTCCCTGGTTCGGCCGAACCCTTCTCGGCCCCATTCGGCCCCCCGTTCGGCAGCGCGATCCCTCTCCCCTCGCCATGTCACAAGGTCAAAAATCC[A/G]
GGGGGATTCGCCTGCAAGATGGCAGACTACGGGAGAGCTCGGCTTGTTAAAGGCACAACGCCTTTTCCAAGATGACGGGAATGCCGCGGCGCCTCTCGCC

Reverse complement sequence

GGCGAGAGGCGCCGCGGCATTCCCGTCATCTTGGAAAAGGCGTTGTGCCTTTAACAAGCCGAGCTCTCCCGTAGTCTGCCATCTTGCAGGCGAATCCCCC[T/C]
GGATTTTTGACCTTGTGACATGGCGAGGGGAGAGGGATCGCGCTGCCGAACGGGGGGCCGAATGGGGCCGAGAAGGGTTCGGCCGAACCAGGGAGCTCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.30% 22.00% 18.18% 32.54% NA
All Indica  2759 16.60% 15.00% 26.28% 42.08% NA
All Japonica  1512 51.70% 33.00% 1.06% 14.22% NA
Aus  269 8.60% 3.30% 39.78% 48.33% NA
Indica I  595 32.60% 3.50% 18.49% 45.38% NA
Indica II  465 9.70% 11.60% 24.95% 53.76% NA
Indica III  913 9.70% 25.00% 31.00% 34.28% NA
Indica Intermediate  786 16.70% 14.10% 27.48% 41.73% NA
Temperate Japonica  767 85.70% 10.30% 0.52% 3.52% NA
Tropical Japonica  504 10.10% 58.50% 0.60% 30.75% NA
Japonica Intermediate  241 30.70% 51.90% 3.73% 13.69% NA
VI/Aromatic  96 1.00% 88.50% 3.12% 7.29% NA
Intermediate  90 28.90% 34.40% 8.89% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812014490 A -> G LOC_Os08g20050.1 splice_acceptor_variant&intron_variant ; HIGH splice_acceptor_variant Average:26.379; most accessible tissue: Callus, score: 55.657 N N N N
vg0812014490 A -> DEL LOC_Os08g20050.1 N splice_acceptor_variant Average:26.379; most accessible tissue: Callus, score: 55.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812014490 NA 7.37E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 4.99E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 1.62E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 2.57E-06 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 7.55E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 2.51E-07 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 6.76E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 6.66E-07 1.20E-06 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 8.00E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 6.72E-06 2.84E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812014490 NA 1.21E-06 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251