\
| Variant ID: vg0812013995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12013995 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGCATGCTTAAAACTCTGTATAGTTGTCGTTTTTGTGCTTAGAATAGGTTTTAGTGGGCCTAGGAAAAATTTGGTGGCCTGCCGGACCCACCAGGGTTC[A/G]
GCCGAACCAAAACCAGGGCGCGCCCGTTCAGCCCCATTTTTGAACAGTAGTCTCCCCCACTCGTCTTGAGTCTGTTTAGATGCGAGTTCGGAGGTAGATC
GATCTACCTCCGAACTCGCATCTAAACAGACTCAAGACGAGTGGGGGAGACTACTGTTCAAAAATGGGGCTGAACGGGCGCGCCCTGGTTTTGGTTCGGC[T/C]
GAACCCTGGTGGGTCCGGCAGGCCACCAAATTTTTCCTAGGCCCACTAAAACCTATTCTAAGCACAAAAACGACAACTATACAGAGTTTTAAGCATGCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 28.70% | 2.48% | 12.10% | NA |
| All Indica | 2759 | 77.20% | 12.80% | 2.17% | 7.83% | NA |
| All Japonica | 1512 | 15.80% | 59.30% | 3.64% | 21.23% | NA |
| Aus | 269 | 97.00% | 1.10% | 0.00% | 1.86% | NA |
| Indica I | 595 | 66.70% | 16.50% | 2.35% | 14.45% | NA |
| Indica II | 465 | 81.10% | 12.00% | 1.51% | 5.38% | NA |
| Indica III | 913 | 82.00% | 10.60% | 2.63% | 4.71% | NA |
| Indica Intermediate | 786 | 77.10% | 13.10% | 1.91% | 7.89% | NA |
| Temperate Japonica | 767 | 4.30% | 68.80% | 2.61% | 24.25% | NA |
| Tropical Japonica | 504 | 32.30% | 45.40% | 4.96% | 17.26% | NA |
| Japonica Intermediate | 241 | 17.80% | 58.10% | 4.15% | 19.92% | NA |
| VI/Aromatic | 96 | 12.50% | 64.60% | 0.00% | 22.92% | NA |
| Intermediate | 90 | 43.30% | 45.60% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812013995 | A -> G | LOC_Os08g20040.1 | downstream_gene_variant ; 3442.0bp to feature; MODIFIER | silent_mutation | Average:50.087; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0812013995 | A -> G | LOC_Os08g20050.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.087; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0812013995 | A -> DEL | N | N | silent_mutation | Average:50.087; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812013995 | NA | 2.05E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 5.94E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 3.09E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 4.44E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 2.45E-06 | mr1735 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | 2.85E-07 | 2.96E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 9.11E-06 | mr1866 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 2.90E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | 3.40E-06 | 3.40E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | 7.72E-06 | 5.96E-28 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 2.06E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 1.92E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | 2.22E-06 | 2.93E-32 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 7.34E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812013995 | NA | 4.84E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |