\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812012209:

Variant ID: vg0812012209 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 12012209
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GGCACTCGTCGCTGCTCAAACCATTCAATCCCCTGATTGGACTCTGCCCTTCGAGATTATGTGTGATGCAAGTGACTTTGCTGTTGGAGCGGTCTTGGGC[T/C]
AAACCAAAGATAAAAAACATCATGCAATCTGTTACGCTAGCAAAACTCTAACCGGAGCTCAGTTGAATTATACAACTACTGAAAAAGAGCTGCTCGCGGT

Reverse complement sequence

ACCGCGAGCAGCTCTTTTTCAGTAGTTGTATAATTCAACTGAGCTCCGGTTAGAGTTTTGCTAGCGTAACAGATTGCATGATGTTTTTTATCTTTGGTTT[A/G]
GCCCAAGACCGCTCCAACAGCAAAGTCACTTGCATCACACATAATCTCGAAGGGCAGAGTCCAATCAGGGGATTGAATGGTTTGAGCAGCGACGAGTGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.00% 5.60% 1.06% 53.30% NA
All Indica  2759 16.50% 9.40% 1.34% 72.71% NA
All Japonica  1512 84.70% 0.20% 0.60% 14.48% NA
Aus  269 5.60% 0.70% 1.49% 92.19% NA
Indica I  595 35.50% 2.50% 1.18% 60.84% NA
Indica II  465 17.20% 5.40% 0.43% 76.99% NA
Indica III  913 2.10% 16.80% 1.64% 79.52% NA
Indica Intermediate  786 18.60% 8.50% 1.65% 71.25% NA
Temperate Japonica  767 96.00% 0.10% 0.26% 3.65% NA
Tropical Japonica  504 68.50% 0.40% 0.99% 30.16% NA
Japonica Intermediate  241 83.00% 0.00% 0.83% 16.18% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 58.90% 2.20% 0.00% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0812012209 T -> C LOC_Os08g20050.1 upstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:10.929; most accessible tissue: Callus, score: 43.457 N N N N
vg0812012209 T -> C LOC_Os08g20040.1 downstream_gene_variant ; 1656.0bp to feature; MODIFIER silent_mutation Average:10.929; most accessible tissue: Callus, score: 43.457 N N N N
vg0812012209 T -> C LOC_Os08g20040-LOC_Os08g20050 intergenic_region ; MODIFIER silent_mutation Average:10.929; most accessible tissue: Callus, score: 43.457 N N N N
vg0812012209 T -> DEL N N silent_mutation Average:10.929; most accessible tissue: Callus, score: 43.457 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0812012209 NA 7.05E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 1.82E-07 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 1.13E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 1.01E-07 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 5.69E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 5.81E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 3.03E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 1.72E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 2.92E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 6.95E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 3.57E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 NA 5.38E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812012209 3.74E-06 NA mr1951_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251