\
| Variant ID: vg0811932204 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11932204 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTGCGAGTTCTTTAGATTTTGCTGGAATGAGGGTATGAGGTTGCCATCTATCGAGGACTGTCCTGGGTGCGGTAATGTTGCAGAAAGTTCAAGCTGATC[G/A]
TATAATAGAGGCAATTGGCTAAAGCAAACAAGGGTTCCTGTTCATCAAAGGTTGGGCCCGGTGAACCAAGATCGTAACCAAGATGACAATGAAGACAGGA
TCCTGTCTTCATTGTCATCTTGGTTACGATCTTGGTTCACCGGGCCCAACCTTTGATGAACAGGAACCCTTGTTTGCTTTAGCCAATTGCCTCTATTATA[C/T]
GATCAGCTTGAACTTTCTGCAACATTACCGCACCCAGGACAGTCCTCGATAGATGGCAACCTCATACCCTCATTCCAGCAAAATCTAAAGAACTCGCAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 9.30% | 4.70% | 14.43% | NA |
| All Indica | 2759 | 83.80% | 9.60% | 4.31% | 2.32% | NA |
| All Japonica | 1512 | 53.60% | 10.40% | 2.18% | 33.80% | NA |
| Aus | 269 | 75.10% | 1.10% | 18.22% | 5.58% | NA |
| Indica I | 595 | 84.20% | 2.40% | 8.40% | 5.04% | NA |
| Indica II | 465 | 88.00% | 5.60% | 3.87% | 2.58% | NA |
| Indica III | 913 | 82.10% | 16.80% | 0.88% | 0.22% | NA |
| Indica Intermediate | 786 | 82.80% | 9.20% | 5.47% | 2.54% | NA |
| Temperate Japonica | 767 | 87.20% | 0.40% | 1.96% | 10.43% | NA |
| Tropical Japonica | 504 | 11.70% | 27.20% | 2.78% | 58.33% | NA |
| Japonica Intermediate | 241 | 34.40% | 7.10% | 1.66% | 56.85% | NA |
| VI/Aromatic | 96 | 7.30% | 8.30% | 11.46% | 72.92% | NA |
| Intermediate | 90 | 55.60% | 8.90% | 11.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811932204 | G -> A | LOC_Os08g19910.1 | upstream_gene_variant ; 4473.0bp to feature; MODIFIER | silent_mutation | Average:16.324; most accessible tissue: Callus, score: 30.592 | N | N | N | N |
| vg0811932204 | G -> A | LOC_Os08g19930.1 | upstream_gene_variant ; 3054.0bp to feature; MODIFIER | silent_mutation | Average:16.324; most accessible tissue: Callus, score: 30.592 | N | N | N | N |
| vg0811932204 | G -> A | LOC_Os08g19920.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.324; most accessible tissue: Callus, score: 30.592 | N | N | N | N |
| vg0811932204 | G -> DEL | N | N | silent_mutation | Average:16.324; most accessible tissue: Callus, score: 30.592 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811932204 | 8.15E-06 | 2.40E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | NA | 1.44E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | NA | 6.40E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | 3.04E-06 | 2.39E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | 1.82E-07 | 1.82E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | 4.57E-07 | 1.05E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | 1.49E-08 | 1.94E-09 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | 2.89E-06 | 2.67E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811932204 | NA | 1.22E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |