\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811932204:

Variant ID: vg0811932204 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11932204
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCGAGTTCTTTAGATTTTGCTGGAATGAGGGTATGAGGTTGCCATCTATCGAGGACTGTCCTGGGTGCGGTAATGTTGCAGAAAGTTCAAGCTGATC[G/A]
TATAATAGAGGCAATTGGCTAAAGCAAACAAGGGTTCCTGTTCATCAAAGGTTGGGCCCGGTGAACCAAGATCGTAACCAAGATGACAATGAAGACAGGA

Reverse complement sequence

TCCTGTCTTCATTGTCATCTTGGTTACGATCTTGGTTCACCGGGCCCAACCTTTGATGAACAGGAACCCTTGTTTGCTTTAGCCAATTGCCTCTATTATA[C/T]
GATCAGCTTGAACTTTCTGCAACATTACCGCACCCAGGACAGTCCTCGATAGATGGCAACCTCATACCCTCATTCCAGCAAAATCTAAAGAACTCGCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 9.30% 4.70% 14.43% NA
All Indica  2759 83.80% 9.60% 4.31% 2.32% NA
All Japonica  1512 53.60% 10.40% 2.18% 33.80% NA
Aus  269 75.10% 1.10% 18.22% 5.58% NA
Indica I  595 84.20% 2.40% 8.40% 5.04% NA
Indica II  465 88.00% 5.60% 3.87% 2.58% NA
Indica III  913 82.10% 16.80% 0.88% 0.22% NA
Indica Intermediate  786 82.80% 9.20% 5.47% 2.54% NA
Temperate Japonica  767 87.20% 0.40% 1.96% 10.43% NA
Tropical Japonica  504 11.70% 27.20% 2.78% 58.33% NA
Japonica Intermediate  241 34.40% 7.10% 1.66% 56.85% NA
VI/Aromatic  96 7.30% 8.30% 11.46% 72.92% NA
Intermediate  90 55.60% 8.90% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811932204 G -> A LOC_Os08g19910.1 upstream_gene_variant ; 4473.0bp to feature; MODIFIER silent_mutation Average:16.324; most accessible tissue: Callus, score: 30.592 N N N N
vg0811932204 G -> A LOC_Os08g19930.1 upstream_gene_variant ; 3054.0bp to feature; MODIFIER silent_mutation Average:16.324; most accessible tissue: Callus, score: 30.592 N N N N
vg0811932204 G -> A LOC_Os08g19920.1 intron_variant ; MODIFIER silent_mutation Average:16.324; most accessible tissue: Callus, score: 30.592 N N N N
vg0811932204 G -> DEL N N silent_mutation Average:16.324; most accessible tissue: Callus, score: 30.592 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811932204 8.15E-06 2.40E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 NA 1.44E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 NA 6.40E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 3.04E-06 2.39E-09 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 1.82E-07 1.82E-07 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 4.57E-07 1.05E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 1.49E-08 1.94E-09 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 2.89E-06 2.67E-09 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204 NA 1.22E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251