\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811930717:

Variant ID: vg0811930717 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 11930717
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGACAATCAGCCAAGGCAGCATGCTGCGAATCAAGTTGGCCCAGAGCACTTGGTTCATCATGTACAGCCAGATCAAACAGTGATACCTCAAGTTGTTCC[T/C]
TAGCATTTGGTGTGCAATATTCAGCCAAATTTTCAAAATTACCAGGGGGCAATTTGAATTATCAATATCAGCCTCCTTCACTGCAAGTTCAATATCAGCA

Reverse complement sequence

TGCTGATATTGAACTTGCAGTGAAGGAGGCTGATATTGATAATTCAAATTGCCCCCTGGTAATTTTGAAAATTTGGCTGAATATTGCACACCAAATGCTA[A/G]
GGAACAACTTGAGGTATCACTGTTTGATCTGGCTGTACATGATGAACCAAGTGCTCTGGGCCAACTTGATTCGCAGCATGCTGCCTTGGCTGATTGTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 17.80% 3.03% 28.33% NA
All Indica  2759 75.40% 1.70% 2.68% 20.22% NA
All Japonica  1512 11.00% 50.90% 1.06% 37.10% NA
Aus  269 39.00% 1.10% 2.60% 57.25% NA
Indica I  595 66.70% 2.00% 3.03% 28.24% NA
Indica II  465 69.90% 3.90% 3.66% 22.58% NA
Indica III  913 90.40% 0.30% 1.10% 8.21% NA
Indica Intermediate  786 67.70% 1.90% 3.69% 26.72% NA
Temperate Japonica  767 0.80% 85.00% 1.17% 13.04% NA
Tropical Japonica  504 28.00% 8.70% 0.60% 62.70% NA
Japonica Intermediate  241 7.90% 30.30% 1.66% 60.17% NA
VI/Aromatic  96 28.10% 1.00% 42.71% 28.12% NA
Intermediate  90 30.00% 21.10% 5.56% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0811930717 T -> C LOC_Os08g19910.1 upstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0811930717 T -> C LOC_Os08g19930.1 upstream_gene_variant ; 4541.0bp to feature; MODIFIER silent_mutation Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0811930717 T -> C LOC_Os08g19920.1 intron_variant ; MODIFIER silent_mutation Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0811930717 T -> DEL N N silent_mutation Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0811930717 NA 2.28E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 NA 2.74E-06 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 NA 1.15E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 NA 1.55E-06 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 NA 1.69E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 NA 2.12E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 2.86E-06 2.79E-08 mr1835 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811930717 6.56E-06 4.68E-07 mr1835 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251