| Variant ID: vg0811930717 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 11930717 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGACAATCAGCCAAGGCAGCATGCTGCGAATCAAGTTGGCCCAGAGCACTTGGTTCATCATGTACAGCCAGATCAAACAGTGATACCTCAAGTTGTTCC[T/C]
TAGCATTTGGTGTGCAATATTCAGCCAAATTTTCAAAATTACCAGGGGGCAATTTGAATTATCAATATCAGCCTCCTTCACTGCAAGTTCAATATCAGCA
TGCTGATATTGAACTTGCAGTGAAGGAGGCTGATATTGATAATTCAAATTGCCCCCTGGTAATTTTGAAAATTTGGCTGAATATTGCACACCAAATGCTA[A/G]
GGAACAACTTGAGGTATCACTGTTTGATCTGGCTGTACATGATGAACCAAGTGCTCTGGGCCAACTTGATTCGCAGCATGCTGCCTTGGCTGATTGTCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 17.80% | 3.03% | 28.33% | NA |
| All Indica | 2759 | 75.40% | 1.70% | 2.68% | 20.22% | NA |
| All Japonica | 1512 | 11.00% | 50.90% | 1.06% | 37.10% | NA |
| Aus | 269 | 39.00% | 1.10% | 2.60% | 57.25% | NA |
| Indica I | 595 | 66.70% | 2.00% | 3.03% | 28.24% | NA |
| Indica II | 465 | 69.90% | 3.90% | 3.66% | 22.58% | NA |
| Indica III | 913 | 90.40% | 0.30% | 1.10% | 8.21% | NA |
| Indica Intermediate | 786 | 67.70% | 1.90% | 3.69% | 26.72% | NA |
| Temperate Japonica | 767 | 0.80% | 85.00% | 1.17% | 13.04% | NA |
| Tropical Japonica | 504 | 28.00% | 8.70% | 0.60% | 62.70% | NA |
| Japonica Intermediate | 241 | 7.90% | 30.30% | 1.66% | 60.17% | NA |
| VI/Aromatic | 96 | 28.10% | 1.00% | 42.71% | 28.12% | NA |
| Intermediate | 90 | 30.00% | 21.10% | 5.56% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0811930717 | T -> C | LOC_Os08g19910.1 | upstream_gene_variant ; 2986.0bp to feature; MODIFIER | silent_mutation | Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0811930717 | T -> C | LOC_Os08g19930.1 | upstream_gene_variant ; 4541.0bp to feature; MODIFIER | silent_mutation | Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0811930717 | T -> C | LOC_Os08g19920.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0811930717 | T -> DEL | N | N | silent_mutation | Average:25.108; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0811930717 | NA | 2.28E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | NA | 2.74E-06 | mr1135 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | NA | 1.15E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | NA | 1.55E-06 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | NA | 1.69E-06 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | NA | 2.12E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | 2.86E-06 | 2.79E-08 | mr1835 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0811930717 | 6.56E-06 | 4.68E-07 | mr1835 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |